ID: 1143982226

View in Genome Browser
Species Human (GRCh38)
Location 17:10879902-10879924
Sequence TTGGTTGTTCACTGGGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143982210_1143982226 30 Left 1143982210 17:10879849-10879871 CCCAGCTCAGTGTCTGCTTAACT No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data
1143982221_1143982226 -4 Left 1143982221 17:10879883-10879905 CCGGCGGAAGGACCAAGGGTTGG No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data
1143982220_1143982226 -3 Left 1143982220 17:10879882-10879904 CCCGGCGGAAGGACCAAGGGTTG No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data
1143982219_1143982226 -2 Left 1143982219 17:10879881-10879903 CCCCGGCGGAAGGACCAAGGGTT No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data
1143982211_1143982226 29 Left 1143982211 17:10879850-10879872 CCAGCTCAGTGTCTGCTTAACTT No data
Right 1143982226 17:10879902-10879924 TTGGTTGTTCACTGGGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143982226 Original CRISPR TTGGTTGTTCACTGGGAACC TGG Intergenic
No off target data available for this crispr