ID: 1143983418

View in Genome Browser
Species Human (GRCh38)
Location 17:10890607-10890629
Sequence CATCGTGACCAGAGTGCCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143983413_1143983418 21 Left 1143983413 17:10890563-10890585 CCCGAAGCAGGTGCACACAGCAG No data
Right 1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG No data
1143983414_1143983418 20 Left 1143983414 17:10890564-10890586 CCGAAGCAGGTGCACACAGCAGG No data
Right 1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG No data
1143983412_1143983418 22 Left 1143983412 17:10890562-10890584 CCCCGAAGCAGGTGCACACAGCA No data
Right 1143983418 17:10890607-10890629 CATCGTGACCAGAGTGCCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143983418 Original CRISPR CATCGTGACCAGAGTGCCGC TGG Intergenic
No off target data available for this crispr