ID: 1143984059

View in Genome Browser
Species Human (GRCh38)
Location 17:10895914-10895936
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143984059_1143984073 20 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984073 17:10895957-10895979 GCTGGGGGTAGGGAGGGCATAGG No data
1143984059_1143984074 21 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG No data
1143984059_1143984062 -5 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984062 17:10895932-10895954 GAAGGTGACACAGAGCTGCCAGG No data
1143984059_1143984072 14 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984072 17:10895951-10895973 CAGGGTGCTGGGGGTAGGGAGGG No data
1143984059_1143984064 2 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984064 17:10895939-10895961 ACACAGAGCTGCCAGGGTGCTGG No data
1143984059_1143984068 9 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984068 17:10895946-10895968 GCTGCCAGGGTGCTGGGGGTAGG No data
1143984059_1143984069 10 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984069 17:10895947-10895969 CTGCCAGGGTGCTGGGGGTAGGG No data
1143984059_1143984063 -4 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984063 17:10895933-10895955 AAGGTGACACAGAGCTGCCAGGG No data
1143984059_1143984071 13 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984071 17:10895950-10895972 CCAGGGTGCTGGGGGTAGGGAGG No data
1143984059_1143984066 4 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984066 17:10895941-10895963 ACAGAGCTGCCAGGGTGCTGGGG No data
1143984059_1143984067 5 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984067 17:10895942-10895964 CAGAGCTGCCAGGGTGCTGGGGG No data
1143984059_1143984065 3 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984065 17:10895940-10895962 CACAGAGCTGCCAGGGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143984059 Original CRISPR CCTTCTGCCCTGATTTAACA GGG (reversed) Intergenic
No off target data available for this crispr