ID: 1143984074

View in Genome Browser
Species Human (GRCh38)
Location 17:10895958-10895980
Sequence CTGGGGGTAGGGAGGGCATA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143984059_1143984074 21 Left 1143984059 17:10895914-10895936 CCCTGTTAAATCAGGGCAGAAGG No data
Right 1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG No data
1143984061_1143984074 20 Left 1143984061 17:10895915-10895937 CCTGTTAAATCAGGGCAGAAGGT No data
Right 1143984074 17:10895958-10895980 CTGGGGGTAGGGAGGGCATAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143984074 Original CRISPR CTGGGGGTAGGGAGGGCATA GGG Intergenic
No off target data available for this crispr