ID: 1143988826

View in Genome Browser
Species Human (GRCh38)
Location 17:10939203-10939225
Sequence CATCATGAGGGGCTGCTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 2, 1: 0, 2: 0, 3: 16, 4: 149}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143988826_1143988837 15 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988837 17:10939241-10939263 GGGGCTCCTTGGAAAAAATTGGG No data
1143988826_1143988832 -5 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988832 17:10939221-10939243 TGATGAATCCAAGAAGTAAGGGG No data
1143988826_1143988836 14 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG No data
1143988826_1143988835 4 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988826_1143988840 26 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988840 17:10939252-10939274 GAAAAAATTGGGGTGTTGTGAGG No data
1143988826_1143988830 -7 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988830 17:10939219-10939241 CATGATGAATCCAAGAAGTAAGG No data
1143988826_1143988838 16 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data
1143988826_1143988831 -6 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988831 17:10939220-10939242 ATGATGAATCCAAGAAGTAAGGG No data
1143988826_1143988833 -4 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988833 17:10939222-10939244 GATGAATCCAAGAAGTAAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143988826 Original CRISPR CATCATGAGGGGCTGCTGTC AGG (reversed) Intergenic
900136737 1:1120971-1120993 CCTCAGGAGGAGCTGCTGTTTGG - Intergenic
900407746 1:2499865-2499887 TCTCAAGAGGGGCTGCTGTGGGG + Intronic
901029851 1:6300726-6300748 CATCAGGATAGGGTGCTGTCTGG - Intronic
901029867 1:6300789-6300811 CATCAGGATAGGGTGCTGTCCGG - Intronic
901168460 1:7236509-7236531 CATCAGGAGGGGGTGCAGTGGGG + Intronic
903343353 1:22668841-22668863 CCACATCAGGGGCTGCTGTGAGG - Intergenic
904340478 1:29830807-29830829 CCTCATGAGGTCCTACTGTCTGG + Intergenic
904841082 1:33372358-33372380 CAGCATGAGGTGCTGCTGCTGGG + Exonic
905245062 1:36606928-36606950 CACCTTGAGGGGCTGGCGTCAGG + Intergenic
908885796 1:68786839-68786861 CATCAGGTGGGACTGCTGGCTGG - Intergenic
910474412 1:87591605-87591627 CATCACCAGCGGCTGCTGTCGGG - Intergenic
914981464 1:152418395-152418417 CTTCATCAGTGTCTGCTGTCAGG + Intergenic
915310012 1:155002035-155002057 CTTCAAGAGGGGCTTCTGTAGGG - Intergenic
1065037547 10:21655128-21655150 GGGCATGAGGGGCTGCTGTAGGG + Intronic
1065261485 10:23928008-23928030 CAGCATCATGGGCTGCTGGCAGG + Intronic
1066558157 10:36638817-36638839 CATCCTTGGGGGCTGCTGTCAGG + Intergenic
1067286791 10:44912841-44912863 GATCATGAAGGGCTGCTGGATGG + Intronic
1070256028 10:74813750-74813772 CTTGCTGAAGGGCTGCTGTCAGG - Intergenic
1070551188 10:77491943-77491965 CATCCCAAGGGGCTGCTGCCTGG - Intronic
1070664504 10:78333680-78333702 CAGCATGAAGGACTGCTGTGTGG + Intergenic
1071365954 10:84900850-84900872 CACCTTGAGGGGCTGCTATGAGG - Intergenic
1078441268 11:11370876-11370898 TTTCACGAGGAGCTGCTGTCAGG - Intronic
1079418588 11:20264339-20264361 GAGGAGGAGGGGCTGCTGTCTGG - Intergenic
1080133383 11:28823511-28823533 CATCTTGAGGGACTGCAGTATGG - Intergenic
1082881447 11:58041874-58041896 CATGATAAGCAGCTGCTGTCAGG - Intronic
1084207740 11:67605771-67605793 CACCTTGTGGGGCTGCTGTGGGG + Intronic
1084743067 11:71151428-71151450 GATGAGGAGTGGCTGCTGTCAGG - Intronic
1084962455 11:72724375-72724397 CATCATGAGGGGTTGCAAGCAGG + Intronic
1085043215 11:73338887-73338909 CTTGATGTGGGGCTGCTGTGGGG + Intronic
1089361066 11:117886988-117887010 CATCATAATGGTCTGCTGTGGGG - Intergenic
1090961181 11:131558347-131558369 AATCATGACGGGCTGCTGGATGG - Intronic
1091338493 11:134792342-134792364 CAGCATGATGGGGCGCTGTCGGG + Intergenic
1092834779 12:12477241-12477263 CTTCGTGAGGTGCTGCTGGCTGG + Exonic
1094735194 12:33226363-33226385 CATCATGAGGGGTACCTGGCAGG + Intergenic
1096386743 12:51199336-51199358 CACCATGAGAGGCTGCCTTCAGG - Intronic
1098544295 12:71694301-71694323 CAGCAAGAGGGGGTGTTGTCAGG + Intronic
1102720147 12:115008804-115008826 TGTAATGAGGGGCTGCTGTGTGG - Intergenic
1102989381 12:117303809-117303831 CAACATGAGGACCTGCTGTTGGG - Intronic
1103323088 12:120102866-120102888 CAGAGTGAGGGGCGGCTGTCTGG - Intronic
1103504283 12:121430998-121431020 CAGCATGAGGGACAGCTGTTTGG + Intronic
1104509207 12:129360714-129360736 GATCAGGAAAGGCTGCTGTCAGG + Intronic
1105890878 13:24681313-24681335 CACCCTGAGGAGCTGCTGGCTGG + Intronic
1109089459 13:58021808-58021830 AATCTTGATGGGCTGCTCTCTGG + Intergenic
1111395252 13:87659133-87659155 CATCATTAGGAAGTGCTGTCTGG + Intergenic
1111413961 13:87913898-87913920 GATTTTTAGGGGCTGCTGTCTGG - Intergenic
1113481664 13:110626097-110626119 CAGGGTGTGGGGCTGCTGTCAGG + Intronic
1117814376 14:59582057-59582079 CATCACAAGGGACTGATGTCAGG - Intergenic
1118732303 14:68677010-68677032 CATCATGAGGGGCTTGTGAGGGG + Intronic
1119924221 14:78476493-78476515 AACCATGAGGGGCTGGGGTCTGG + Intronic
1120407965 14:84113383-84113405 CTTGATGAGGGTCTGCTCTCTGG - Intergenic
1121693244 14:95892756-95892778 CACCATGCAGGGCTGCTGTGGGG + Intergenic
1123208601 14:106737545-106737567 CATGGTGAGGTGCTGCTCTCTGG + Intergenic
1123469893 15:20541875-20541897 CTTCATGACACGCTGCTGTCTGG - Intergenic
1123698109 15:22893976-22893998 CATCAGGAGGCGCTACGGTCAGG + Intronic
1124795326 15:32772809-32772831 ATTCCTGAGGGGCTGCTGGCTGG + Exonic
1129543123 15:76367550-76367572 CAGCCTGAGGGGCTGCTGCCAGG - Intronic
1132076803 15:98828256-98828278 CTTCAGGAAGGGCTGCTGTTGGG + Intronic
1132872732 16:2122984-2123006 CATCAAGAGTGGCTGCTGCTGGG + Intronic
1133000763 16:2850321-2850343 CATTCTCAGGGGCTTCTGTCAGG + Intergenic
1134551819 16:15142163-15142185 CATCAAGAGTGGCTGCTGCTGGG + Intergenic
1134841447 16:17405199-17405221 CATCATGTTGTGCTGCTGCCTGG - Intronic
1141405097 16:83785609-83785631 CTTCGTGAGGGTATGCTGTCTGG + Intronic
1141426521 16:83947779-83947801 CAGCACCAGGGGCTGCTGTGTGG + Intronic
1142306039 16:89286288-89286310 GACCGTGAGGGGCTGCTCTCGGG - Intronic
1142808363 17:2383543-2383565 CTTCCTGAGGGGCTGCTCTGGGG - Intergenic
1143570831 17:7757251-7757273 CATCTTGAAGGGCTGCAGTGAGG - Intronic
1143988826 17:10939203-10939225 CATCATGAGGGGCTGCTGTCAGG - Intergenic
1146249479 17:31326058-31326080 TATCATGAGCGGCTGCTGACTGG + Exonic
1147677497 17:42218355-42218377 CATGATGAGGGGCTGGTGCAGGG + Intronic
1147896885 17:43757052-43757074 CATCGTCTGGGGCTGCTTTCTGG + Intronic
1150139654 17:62717265-62717287 TAGCATGGGCGGCTGCTGTCTGG - Intronic
1153285329 18:3450688-3450710 CAACACGAGGGGCTGTTGTGGGG + Intronic
1155472404 18:26204787-26204809 CATCCTGAGCAGCTGCTCTCTGG + Intergenic
1157193559 18:45601102-45601124 CATCCTGAGGGGAGGCAGTCAGG - Intronic
1160022220 18:75189834-75189856 CACCATGAGGGGCTGAAGGCAGG + Intergenic
1160846855 19:1169796-1169818 CACCAGGAGGGGCACCTGTCCGG + Intronic
1161479064 19:4501640-4501662 CATCACTGTGGGCTGCTGTCTGG + Intronic
1162139483 19:8577307-8577329 CATGGTGGGGGGCTGGTGTCTGG + Exonic
1162477207 19:10907795-10907817 CTGCATGTGGGGCTGCTGTCTGG - Intronic
1163108801 19:15144460-15144482 CATCATGTGGGGCGGCTGGCTGG - Intergenic
926165833 2:10521838-10521860 AAACCTGAGGGGCAGCTGTCTGG + Intergenic
927204155 2:20596514-20596536 CCTGGTGAGGGCCTGCTGTCTGG - Intronic
928312936 2:30225257-30225279 GTTCAGGAGGAGCTGCTGTCTGG + Intergenic
929314168 2:40457474-40457496 CATCTTCAAGGGCTACTGTCTGG - Intronic
930118977 2:47744333-47744355 CATCATGTGGGGCAGCTGCCTGG - Intronic
931746146 2:65293564-65293586 GTTCAGCAGGGGCTGCTGTCAGG + Intergenic
932219075 2:69986418-69986440 GCTCATGAGGGGCTGCCCTCTGG + Intergenic
932951788 2:76302214-76302236 CATCATGAAGGAGTGCTGTTGGG - Intergenic
933567499 2:83969056-83969078 CTTCATGGGGGGCAGCTGTCTGG + Intergenic
935402628 2:102676075-102676097 CAGCATGAGTTGCTGCTTTCTGG - Intronic
936159305 2:110071783-110071805 CTTCATCAGCCGCTGCTGTCTGG - Intergenic
936185356 2:110299549-110299571 CTTCATCAGCCGCTGCTGTCTGG + Intergenic
938061795 2:128260879-128260901 CATCATCAGGCGGTGCTGCCCGG + Intronic
939017776 2:136921169-136921191 CATCTGGAGCGGCTGCTGTAAGG - Intronic
940240831 2:151561554-151561576 AAAAGTGAGGGGCTGCTGTCAGG - Intronic
940582762 2:155601592-155601614 CATCTGGAGTGGCTGCTGTGAGG - Intergenic
940739567 2:157491937-157491959 CATCTTGAAGGGTTGCTGTGAGG - Intergenic
941162561 2:162052400-162052422 CACCATGTGGGGATGCTGCCTGG + Intronic
945028535 2:205642443-205642465 CATCCTGAGAGGGGGCTGTCTGG - Intergenic
1175661286 20:60815136-60815158 GGTCATGAGGGGCTGGTGTGAGG - Intergenic
1175947463 20:62565547-62565569 CATGCTGAGGGGCTCCTGTTTGG - Intronic
1176222237 20:63975216-63975238 CAGCATGTGGGGCAGCTGCCTGG - Exonic
1179110914 21:38444356-38444378 CTTCATGAGGGGCTGCTCGGAGG + Intronic
1179345826 21:40556579-40556601 CACCATGAGTGGAAGCTGTCTGG - Intronic
1179511284 21:41875334-41875356 CATCAGGTGGAGCTGCCGTCCGG - Intronic
1183121971 22:35737071-35737093 CATCCTCAGGGGCTGCTTCCAGG + Intergenic
1183735578 22:39643063-39643085 GCTCATCAGGGGCGGCTGTCGGG + Intronic
1184684400 22:46089610-46089632 CACCTGGAGGGGCTGCTGGCAGG + Intronic
1185145166 22:49129860-49129882 CACCATGTGGGGCTGCTGAGAGG - Intergenic
950458685 3:13107957-13107979 CAGCATGCGGGGCTGCTCCCCGG - Intergenic
950471423 3:13188977-13188999 CCTCCTGAGGGGGTGCTGCCAGG - Intergenic
956013268 3:64854294-64854316 AATAGTGAGGGGCTGCTGCCTGG + Intergenic
956727418 3:72167989-72168011 CTTCATTAGGGGCTGCTCTCAGG + Intergenic
961125283 3:124412109-124412131 CCTCACAAGGGGCTGCTGTCTGG - Intronic
967832184 3:193929037-193929059 CATCCTGAGAGGCTGCTGGGAGG + Intergenic
968568422 4:1327061-1327083 CCACATGTGGGGCTGCTGGCTGG - Intronic
968903400 4:3441321-3441343 CATCACCAGGGGCTGCTGGGGGG + Intergenic
969082358 4:4628596-4628618 AATCAGGAGGGGCTGCTGATAGG - Intergenic
971727410 4:30331460-30331482 CATCATGTGGGGCAGCCATCCGG + Intergenic
976365542 4:84229059-84229081 CATCCTAAGGGTCTGCTTTCTGG + Intergenic
977872868 4:102113864-102113886 CAACATTGGGGGCTGCTGTGAGG - Intergenic
982572416 4:157066901-157066923 TCTGATGAGGGGCTGCTTTCTGG - Intergenic
984162591 4:176272468-176272490 CTTCTTGAGGAGCTGCTGTAAGG - Intronic
986249532 5:6043973-6043995 CATCCTGAGGGGCAGCTGGTGGG - Intergenic
987502136 5:18726300-18726322 GATCATGATTGGATGCTGTCAGG + Intergenic
990617772 5:57524726-57524748 CATCAGAAGGAGCTGCTGTCTGG - Intergenic
995232334 5:109781921-109781943 CATCATGAGTGTCTGCAGGCTGG + Intronic
998999172 5:147901004-147901026 CATCATGAGAGACTGCCTTCGGG - Intronic
1000290013 5:159861305-159861327 CATCTTGAGGGGGTGGTGGCTGG + Intergenic
1001334637 5:170787427-170787449 CAGCTTCAGGAGCTGCTGTCAGG - Intronic
1001462031 5:171924644-171924666 TGTCATGCGGGGCTGCTGCCTGG - Intronic
1001733109 5:173974479-173974501 CAGCATGCGGGGCTGCTAACAGG - Intronic
1004181000 6:13380487-13380509 TATCATGATGGGGTGCTGGCGGG + Intronic
1012839001 6:104305891-104305913 CATCATGAGGCGTTGCTCTCTGG - Intergenic
1017342411 6:153340328-153340350 CATCATTTGTGTCTGCTGTCCGG - Intergenic
1019369818 7:655913-655935 CAGCATGTGAGGCTGCTCTCTGG + Intronic
1029548864 7:101225920-101225942 CATGTTGGGGGGCTGATGTCAGG + Intergenic
1029638219 7:101800313-101800335 CATAATGAGAGGCTGCTGAGTGG - Intergenic
1030990218 7:116290799-116290821 CATCATGAGGGGCTGCTGTCTGG - Intronic
1031156334 7:118116110-118116132 CTTCATGAGGGGCTGGCCTCAGG + Intergenic
1033165041 7:139032497-139032519 CATCATGGTGGGCGCCTGTCGGG + Intronic
1033685827 7:143640545-143640567 CTTCATAAGGGGCAGCTCTCCGG + Intronic
1033689916 7:143726770-143726792 CTTCATAAGGGGCAGCTCTCCGG - Intronic
1033698787 7:143817076-143817098 CTTCATAAGGGGCAGCTCTCCGG - Intergenic
1034122720 7:148642097-148642119 CATCAGGAGGGGGTGCTTTTTGG - Intergenic
1034356223 7:150452346-150452368 CATCATGTGGAGCTGCAGGCAGG + Intronic
1035930727 8:3777341-3777363 CATCTGGAGGCACTGCTGTCTGG - Intronic
1036424191 8:8628247-8628269 CGTCCTGAGGGACTGCTCTCAGG + Intergenic
1038403109 8:27300431-27300453 TCTCATGAGGGGCTGCAGTCAGG - Intronic
1039028747 8:33286574-33286596 CTCCATGAGGGGCAGGTGTCAGG + Intergenic
1042089756 8:65145825-65145847 GATCAAGAGGGGCTGCTGCTTGG + Intergenic
1043414483 8:80033435-80033457 TGTCATGTGGGGCAGCTGTCTGG + Intronic
1049389470 8:142360580-142360602 CAGCCTGAGGGGCTGGTGGCTGG - Intronic
1049566894 8:143344963-143344985 CATCAGCACGGGCTGCAGTCTGG + Intronic
1052644229 9:31211454-31211476 CATCTGGAGTGGCTGCTGTGAGG - Intergenic
1053353730 9:37429940-37429962 CATGTCCAGGGGCTGCTGTCTGG + Intronic
1057673434 9:97116676-97116698 CACCATGAAGGGCTGCTGTGAGG + Intergenic
1060996796 9:127878573-127878595 CACCATCTGGGGCTGCTGCCTGG - Intergenic
1061010177 9:127950099-127950121 CAGCTCGTGGGGCTGCTGTCAGG + Intronic
1061655918 9:132089996-132090018 CATAATGAGAGGCTGATGCCAGG + Intergenic
1061904950 9:133692034-133692056 CCTCATAAGGGGAAGCTGTCAGG - Intronic
1188004109 X:25005604-25005626 CAGGATGTGGGGCTGCTGGCAGG - Intronic
1189311370 X:40020485-40020507 CCTCATGAGTAGCTGCTGGCTGG - Intergenic
1194348027 X:92790675-92790697 CTGCATGAGGGGCTGCTGGCTGG + Intergenic
1199088604 X:143663599-143663621 GATTATGAGGGGCTGCGGTAGGG + Intergenic
1200656355 Y:5907305-5907327 CTGCATGAGGGGCTGCTGGCTGG + Intergenic
1201146802 Y:11069187-11069209 GATGAGGAGTGGCTGCTGTCAGG - Intergenic