ID: 1143988828

View in Genome Browser
Species Human (GRCh38)
Location 17:10939215-10939237
Sequence ACTTCTTGGATTCATCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143988828_1143988841 27 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988841 17:10939265-10939287 TGTTGTGAGGAAGCAGACATTGG No data
1143988828_1143988838 4 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data
1143988828_1143988840 14 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988840 17:10939252-10939274 GAAAAAATTGGGGTGTTGTGAGG No data
1143988828_1143988835 -8 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988828_1143988836 2 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988836 17:10939240-10939262 GGGGGCTCCTTGGAAAAAATTGG No data
1143988828_1143988837 3 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988837 17:10939241-10939263 GGGGCTCCTTGGAAAAAATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143988828 Original CRISPR ACTTCTTGGATTCATCATGA GGG (reversed) Intergenic
No off target data available for this crispr