ID: 1143988835

View in Genome Browser
Species Human (GRCh38)
Location 17:10939230-10939252
Sequence CAAGAAGTAAGGGGGCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143988827_1143988835 -7 Left 1143988827 17:10939214-10939236 CCCCTCATGATGAATCCAAGAAG No data
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988824_1143988835 27 Left 1143988824 17:10939180-10939202 CCTGACCAGGAGGGGGTGGGCAA No data
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988828_1143988835 -8 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988829_1143988835 -9 Left 1143988829 17:10939216-10939238 CCTCATGATGAATCCAAGAAGTA No data
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988825_1143988835 22 Left 1143988825 17:10939185-10939207 CCAGGAGGGGGTGGGCAACCTGA No data
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data
1143988826_1143988835 4 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988835 17:10939230-10939252 CAAGAAGTAAGGGGGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143988835 Original CRISPR CAAGAAGTAAGGGGGCTCCT TGG Intergenic
No off target data available for this crispr