ID: 1143988838

View in Genome Browser
Species Human (GRCh38)
Location 17:10939242-10939264
Sequence GGGCTCCTTGGAAAAAATTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143988826_1143988838 16 Left 1143988826 17:10939203-10939225 CCTGACAGCAGCCCCTCATGATG 0: 2
1: 0
2: 0
3: 16
4: 149
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data
1143988829_1143988838 3 Left 1143988829 17:10939216-10939238 CCTCATGATGAATCCAAGAAGTA No data
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data
1143988827_1143988838 5 Left 1143988827 17:10939214-10939236 CCCCTCATGATGAATCCAAGAAG No data
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data
1143988828_1143988838 4 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data
1143988834_1143988838 -10 Left 1143988834 17:10939229-10939251 CCAAGAAGTAAGGGGGCTCCTTG No data
Right 1143988838 17:10939242-10939264 GGGCTCCTTGGAAAAAATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143988838 Original CRISPR GGGCTCCTTGGAAAAAATTG GGG Intergenic
No off target data available for this crispr