ID: 1143988841

View in Genome Browser
Species Human (GRCh38)
Location 17:10939265-10939287
Sequence TGTTGTGAGGAAGCAGACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143988839_1143988841 -5 Left 1143988839 17:10939247-10939269 CCTTGGAAAAAATTGGGGTGTTG No data
Right 1143988841 17:10939265-10939287 TGTTGTGAGGAAGCAGACATTGG No data
1143988827_1143988841 28 Left 1143988827 17:10939214-10939236 CCCCTCATGATGAATCCAAGAAG No data
Right 1143988841 17:10939265-10939287 TGTTGTGAGGAAGCAGACATTGG No data
1143988834_1143988841 13 Left 1143988834 17:10939229-10939251 CCAAGAAGTAAGGGGGCTCCTTG No data
Right 1143988841 17:10939265-10939287 TGTTGTGAGGAAGCAGACATTGG No data
1143988828_1143988841 27 Left 1143988828 17:10939215-10939237 CCCTCATGATGAATCCAAGAAGT No data
Right 1143988841 17:10939265-10939287 TGTTGTGAGGAAGCAGACATTGG No data
1143988829_1143988841 26 Left 1143988829 17:10939216-10939238 CCTCATGATGAATCCAAGAAGTA No data
Right 1143988841 17:10939265-10939287 TGTTGTGAGGAAGCAGACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143988841 Original CRISPR TGTTGTGAGGAAGCAGACAT TGG Intergenic
No off target data available for this crispr