ID: 1143992748

View in Genome Browser
Species Human (GRCh38)
Location 17:10980471-10980493
Sequence ATTCTACCGTATGTGAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143992745_1143992748 14 Left 1143992745 17:10980434-10980456 CCTGGCCTGATGAGGTGGGCTCT No data
Right 1143992748 17:10980471-10980493 ATTCTACCGTATGTGAAGGTTGG No data
1143992746_1143992748 9 Left 1143992746 17:10980439-10980461 CCTGATGAGGTGGGCTCTGAGTT No data
Right 1143992748 17:10980471-10980493 ATTCTACCGTATGTGAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143992748 Original CRISPR ATTCTACCGTATGTGAAGGT TGG Intergenic
No off target data available for this crispr