ID: 1143995865

View in Genome Browser
Species Human (GRCh38)
Location 17:11005980-11006002
Sequence GACTCAAAGGGGGTCTTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143995865_1143995873 -1 Left 1143995865 17:11005980-11006002 CCCCTCAAGACCCCCTTTGAGTC No data
Right 1143995873 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data
1143995865_1143995875 14 Left 1143995865 17:11005980-11006002 CCCCTCAAGACCCCCTTTGAGTC No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995865_1143995878 16 Left 1143995865 17:11005980-11006002 CCCCTCAAGACCCCCTTTGAGTC No data
Right 1143995878 17:11006019-11006041 CAATGGCAGCTCCCTTCCTGGGG No data
1143995865_1143995877 15 Left 1143995865 17:11005980-11006002 CCCCTCAAGACCCCCTTTGAGTC No data
Right 1143995877 17:11006018-11006040 CCAATGGCAGCTCCCTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143995865 Original CRISPR GACTCAAAGGGGGTCTTGAG GGG (reversed) Intergenic
No off target data available for this crispr