ID: 1143995873

View in Genome Browser
Species Human (GRCh38)
Location 17:11006002-11006024
Sequence CCTTGTGTTACTTTGCCCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143995866_1143995873 -2 Left 1143995866 17:11005981-11006003 CCCTCAAGACCCCCTTTGAGTCC No data
Right 1143995873 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data
1143995867_1143995873 -3 Left 1143995867 17:11005982-11006004 CCTCAAGACCCCCTTTGAGTCCT No data
Right 1143995873 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data
1143995865_1143995873 -1 Left 1143995865 17:11005980-11006002 CCCCTCAAGACCCCCTTTGAGTC No data
Right 1143995873 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data
1143995863_1143995873 20 Left 1143995863 17:11005959-11005981 CCAGCTTCTTCCTGTATGAGGCC No data
Right 1143995873 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data
1143995864_1143995873 10 Left 1143995864 17:11005969-11005991 CCTGTATGAGGCCCCTCAAGACC No data
Right 1143995873 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143995873 Original CRISPR CCTTGTGTTACTTTGCCCAA TGG Intergenic
No off target data available for this crispr