ID: 1143995875

View in Genome Browser
Species Human (GRCh38)
Location 17:11006017-11006039
Sequence CCCAATGGCAGCTCCCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143995868_1143995875 4 Left 1143995868 17:11005990-11006012 CCCCCTTTGAGTCCTTGTGTTAC No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995864_1143995875 25 Left 1143995864 17:11005969-11005991 CCTGTATGAGGCCCCTCAAGACC No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995869_1143995875 3 Left 1143995869 17:11005991-11006013 CCCCTTTGAGTCCTTGTGTTACT No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995867_1143995875 12 Left 1143995867 17:11005982-11006004 CCTCAAGACCCCCTTTGAGTCCT No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995866_1143995875 13 Left 1143995866 17:11005981-11006003 CCCTCAAGACCCCCTTTGAGTCC No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995865_1143995875 14 Left 1143995865 17:11005980-11006002 CCCCTCAAGACCCCCTTTGAGTC No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995870_1143995875 2 Left 1143995870 17:11005992-11006014 CCCTTTGAGTCCTTGTGTTACTT No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995871_1143995875 1 Left 1143995871 17:11005993-11006015 CCTTTGAGTCCTTGTGTTACTTT No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data
1143995872_1143995875 -8 Left 1143995872 17:11006002-11006024 CCTTGTGTTACTTTGCCCAATGG No data
Right 1143995875 17:11006017-11006039 CCCAATGGCAGCTCCCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143995875 Original CRISPR CCCAATGGCAGCTCCCTTCC TGG Intergenic
No off target data available for this crispr