ID: 1143996819

View in Genome Browser
Species Human (GRCh38)
Location 17:11013626-11013648
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143996819_1143996826 25 Left 1143996819 17:11013626-11013648 CCATGACCTGTCTGTTTTTTCAT No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143996819 Original CRISPR ATGAAAAAACAGACAGGTCA TGG (reversed) Intergenic
No off target data available for this crispr