ID: 1143996823

View in Genome Browser
Species Human (GRCh38)
Location 17:11013660-11013682
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143996823_1143996829 10 Left 1143996823 17:11013660-11013682 CCCAGCTGCATCTCCACAGCTGC No data
Right 1143996829 17:11013693-11013715 AAGGAATGACAGTGTGAAGGAGG No data
1143996823_1143996828 7 Left 1143996823 17:11013660-11013682 CCCAGCTGCATCTCCACAGCTGC No data
Right 1143996828 17:11013690-11013712 AAGAAGGAATGACAGTGTGAAGG No data
1143996823_1143996826 -9 Left 1143996823 17:11013660-11013682 CCCAGCTGCATCTCCACAGCTGC No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143996823 Original CRISPR GCAGCTGTGGAGATGCAGCT GGG (reversed) Intergenic
No off target data available for this crispr