ID: 1143996826

View in Genome Browser
Species Human (GRCh38)
Location 17:11013674-11013696
Sequence CACAGCTGCCACATTAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143996824_1143996826 -10 Left 1143996824 17:11013661-11013683 CCAGCTGCATCTCCACAGCTGCC No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data
1143996820_1143996826 19 Left 1143996820 17:11013632-11013654 CCTGTCTGTTTTTTCATTCCACT No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data
1143996823_1143996826 -9 Left 1143996823 17:11013660-11013682 CCCAGCTGCATCTCCACAGCTGC No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data
1143996819_1143996826 25 Left 1143996819 17:11013626-11013648 CCATGACCTGTCTGTTTTTTCAT No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data
1143996821_1143996826 1 Left 1143996821 17:11013650-11013672 CCACTGTGTCCCCAGCTGCATCT No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data
1143996818_1143996826 26 Left 1143996818 17:11013625-11013647 CCCATGACCTGTCTGTTTTTTCA No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data
1143996822_1143996826 -8 Left 1143996822 17:11013659-11013681 CCCCAGCTGCATCTCCACAGCTG No data
Right 1143996826 17:11013674-11013696 CACAGCTGCCACATTAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143996826 Original CRISPR CACAGCTGCCACATTAAAGA AGG Intergenic
No off target data available for this crispr