ID: 1143996828

View in Genome Browser
Species Human (GRCh38)
Location 17:11013690-11013712
Sequence AAGAAGGAATGACAGTGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1143996821_1143996828 17 Left 1143996821 17:11013650-11013672 CCACTGTGTCCCCAGCTGCATCT No data
Right 1143996828 17:11013690-11013712 AAGAAGGAATGACAGTGTGAAGG No data
1143996822_1143996828 8 Left 1143996822 17:11013659-11013681 CCCCAGCTGCATCTCCACAGCTG No data
Right 1143996828 17:11013690-11013712 AAGAAGGAATGACAGTGTGAAGG No data
1143996823_1143996828 7 Left 1143996823 17:11013660-11013682 CCCAGCTGCATCTCCACAGCTGC No data
Right 1143996828 17:11013690-11013712 AAGAAGGAATGACAGTGTGAAGG No data
1143996824_1143996828 6 Left 1143996824 17:11013661-11013683 CCAGCTGCATCTCCACAGCTGCC No data
Right 1143996828 17:11013690-11013712 AAGAAGGAATGACAGTGTGAAGG No data
1143996825_1143996828 -6 Left 1143996825 17:11013673-11013695 CCACAGCTGCCACATTAAAGAAG No data
Right 1143996828 17:11013690-11013712 AAGAAGGAATGACAGTGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1143996828 Original CRISPR AAGAAGGAATGACAGTGTGA AGG Intergenic
No off target data available for this crispr