ID: 1144001570

View in Genome Browser
Species Human (GRCh38)
Location 17:11059998-11060020
Sequence GTGTGCAATGCTCCCCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144001570_1144001574 8 Left 1144001570 17:11059998-11060020 CCTTCCAGGGGAGCATTGCACAC No data
Right 1144001574 17:11060029-11060051 CTGTAGTTCTGTGGTCTTGATGG No data
1144001570_1144001573 -1 Left 1144001570 17:11059998-11060020 CCTTCCAGGGGAGCATTGCACAC No data
Right 1144001573 17:11060020-11060042 CTGGCAGCTCTGTAGTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144001570 Original CRISPR GTGTGCAATGCTCCCCTGGA AGG (reversed) Intergenic
No off target data available for this crispr