ID: 1144006606

View in Genome Browser
Species Human (GRCh38)
Location 17:11106082-11106104
Sequence TGAGTGAAACAGGATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144006606_1144006618 30 Left 1144006606 17:11106082-11106104 CCCTCCTCATCCTGTTTCACTCA No data
Right 1144006618 17:11106135-11106157 GGACCAGGTCATGACTGCGATGG No data
1144006606_1144006612 -8 Left 1144006606 17:11106082-11106104 CCCTCCTCATCCTGTTTCACTCA No data
Right 1144006612 17:11106097-11106119 TTCACTCAAGAAAGGGAACCTGG No data
1144006606_1144006617 15 Left 1144006606 17:11106082-11106104 CCCTCCTCATCCTGTTTCACTCA No data
Right 1144006617 17:11106120-11106142 TGGGTGACAATGTCAGGACCAGG No data
1144006606_1144006614 -4 Left 1144006606 17:11106082-11106104 CCCTCCTCATCCTGTTTCACTCA No data
Right 1144006614 17:11106101-11106123 CTCAAGAAAGGGAACCTGGTGGG No data
1144006606_1144006615 9 Left 1144006606 17:11106082-11106104 CCCTCCTCATCCTGTTTCACTCA No data
Right 1144006615 17:11106114-11106136 ACCTGGTGGGTGACAATGTCAGG No data
1144006606_1144006613 -5 Left 1144006606 17:11106082-11106104 CCCTCCTCATCCTGTTTCACTCA No data
Right 1144006613 17:11106100-11106122 ACTCAAGAAAGGGAACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144006606 Original CRISPR TGAGTGAAACAGGATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr