ID: 1144013434

View in Genome Browser
Species Human (GRCh38)
Location 17:11171695-11171717
Sequence ACCCATACCCTACTGTGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144013430_1144013434 8 Left 1144013430 17:11171664-11171686 CCCTATCGCCTAAGAAGAAGGGT No data
Right 1144013434 17:11171695-11171717 ACCCATACCCTACTGTGTGGTGG No data
1144013426_1144013434 16 Left 1144013426 17:11171656-11171678 CCACACCTCCCTATCGCCTAAGA No data
Right 1144013434 17:11171695-11171717 ACCCATACCCTACTGTGTGGTGG No data
1144013427_1144013434 11 Left 1144013427 17:11171661-11171683 CCTCCCTATCGCCTAAGAAGAAG No data
Right 1144013434 17:11171695-11171717 ACCCATACCCTACTGTGTGGTGG No data
1144013432_1144013434 0 Left 1144013432 17:11171672-11171694 CCTAAGAAGAAGGGTATCTTAGC No data
Right 1144013434 17:11171695-11171717 ACCCATACCCTACTGTGTGGTGG No data
1144013431_1144013434 7 Left 1144013431 17:11171665-11171687 CCTATCGCCTAAGAAGAAGGGTA No data
Right 1144013434 17:11171695-11171717 ACCCATACCCTACTGTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144013434 Original CRISPR ACCCATACCCTACTGTGTGG TGG Intergenic
No off target data available for this crispr