ID: 1144013819

View in Genome Browser
Species Human (GRCh38)
Location 17:11174789-11174811
Sequence CTGCTTGTCCAGGTTGAGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144013815_1144013819 -3 Left 1144013815 17:11174769-11174791 CCCTTCATCAGTGAATGCCTCTG No data
Right 1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG No data
1144013816_1144013819 -4 Left 1144013816 17:11174770-11174792 CCTTCATCAGTGAATGCCTCTGC No data
Right 1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG No data
1144013812_1144013819 13 Left 1144013812 17:11174753-11174775 CCTCATCCTCCATCTGCCCTTCA No data
Right 1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG No data
1144013813_1144013819 7 Left 1144013813 17:11174759-11174781 CCTCCATCTGCCCTTCATCAGTG No data
Right 1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG No data
1144013814_1144013819 4 Left 1144013814 17:11174762-11174784 CCATCTGCCCTTCATCAGTGAAT No data
Right 1144013819 17:11174789-11174811 CTGCTTGTCCAGGTTGAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144013819 Original CRISPR CTGCTTGTCCAGGTTGAGCT CGG Intergenic
No off target data available for this crispr