ID: 1144013937

View in Genome Browser
Species Human (GRCh38)
Location 17:11175833-11175855
Sequence CTTCCGCTAGAACCCCAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144013935_1144013937 21 Left 1144013935 17:11175789-11175811 CCAAGTACTGTGTGCTGGTGTTC No data
Right 1144013937 17:11175833-11175855 CTTCCGCTAGAACCCCAAAGTGG No data
1144013936_1144013937 -3 Left 1144013936 17:11175813-11175835 CCTAAACACTGCAAATAGTTCTT No data
Right 1144013937 17:11175833-11175855 CTTCCGCTAGAACCCCAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144013937 Original CRISPR CTTCCGCTAGAACCCCAAAG TGG Intergenic
No off target data available for this crispr