ID: 1144018594

View in Genome Browser
Species Human (GRCh38)
Location 17:11220552-11220574
Sequence TATTCCACCTTAATTTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144018594_1144018599 25 Left 1144018594 17:11220552-11220574 CCACCACAAATTAAGGTGGAATA No data
Right 1144018599 17:11220600-11220622 ACTCTATAGATGACCCCGGGAGG No data
1144018594_1144018598 22 Left 1144018594 17:11220552-11220574 CCACCACAAATTAAGGTGGAATA No data
Right 1144018598 17:11220597-11220619 TGCACTCTATAGATGACCCCGGG No data
1144018594_1144018597 21 Left 1144018594 17:11220552-11220574 CCACCACAAATTAAGGTGGAATA No data
Right 1144018597 17:11220596-11220618 CTGCACTCTATAGATGACCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144018594 Original CRISPR TATTCCACCTTAATTTGTGG TGG (reversed) Intergenic
No off target data available for this crispr