ID: 1144018682

View in Genome Browser
Species Human (GRCh38)
Location 17:11221155-11221177
Sequence CCTTCTAGGGTGAGGATGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144018673_1144018682 11 Left 1144018673 17:11221121-11221143 CCAAAGGTGTCCTGGAAAATGGA No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data
1144018667_1144018682 24 Left 1144018667 17:11221108-11221130 CCCTTGTCCCTCTCCAAAGGTGT No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data
1144018675_1144018682 1 Left 1144018675 17:11221131-11221153 CCTGGAAAATGGAGGCTTACAAG No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data
1144018670_1144018682 17 Left 1144018670 17:11221115-11221137 CCCTCTCCAAAGGTGTCCTGGAA No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data
1144018671_1144018682 16 Left 1144018671 17:11221116-11221138 CCTCTCCAAAGGTGTCCTGGAAA No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data
1144018668_1144018682 23 Left 1144018668 17:11221109-11221131 CCTTGTCCCTCTCCAAAGGTGTC No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data
1144018665_1144018682 30 Left 1144018665 17:11221102-11221124 CCTTGTCCCTTGTCCCTCTCCAA No data
Right 1144018682 17:11221155-11221177 CCTTCTAGGGTGAGGATGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144018682 Original CRISPR CCTTCTAGGGTGAGGATGTG GGG Intergenic
No off target data available for this crispr