ID: 1144020035

View in Genome Browser
Species Human (GRCh38)
Location 17:11232753-11232775
Sequence GATACTGGTAGTCCAAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144020035_1144020038 2 Left 1144020035 17:11232753-11232775 CCTAATTTTGGACTACCAGTATC No data
Right 1144020038 17:11232778-11232800 GAACTGTAAGACAATAAGTTCGG No data
1144020035_1144020039 12 Left 1144020035 17:11232753-11232775 CCTAATTTTGGACTACCAGTATC No data
Right 1144020039 17:11232788-11232810 ACAATAAGTTCGGTTGTTTAAGG No data
1144020035_1144020040 26 Left 1144020035 17:11232753-11232775 CCTAATTTTGGACTACCAGTATC No data
Right 1144020040 17:11232802-11232824 TGTTTAAGGCTTTCAGTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144020035 Original CRISPR GATACTGGTAGTCCAAAATT AGG (reversed) Intergenic
No off target data available for this crispr