ID: 1144021331

View in Genome Browser
Species Human (GRCh38)
Location 17:11241608-11241630
Sequence CCGGGCGCCCGGAATCCCGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144021318_1144021331 23 Left 1144021318 17:11241562-11241584 CCGGGGGCGCCCTGGCACGGGGC 0: 1
1: 0
2: 2
3: 23
4: 257
Right 1144021331 17:11241608-11241630 CCGGGCGCCCGGAATCCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1144021320_1144021331 14 Left 1144021320 17:11241571-11241593 CCCTGGCACGGGGCGGCCGCGAG 0: 1
1: 0
2: 1
3: 5
4: 110
Right 1144021331 17:11241608-11241630 CCGGGCGCCCGGAATCCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1144021321_1144021331 13 Left 1144021321 17:11241572-11241594 CCTGGCACGGGGCGGCCGCGAGC 0: 1
1: 0
2: 1
3: 16
4: 174
Right 1144021331 17:11241608-11241630 CCGGGCGCCCGGAATCCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1144021323_1144021331 -2 Left 1144021323 17:11241587-11241609 CCGCGAGCTGAACGGCACCGCCC 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1144021331 17:11241608-11241630 CCGGGCGCCCGGAATCCCGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144021331 Original CRISPR CCGGGCGCCCGGAATCCCGG AGG Exonic
902214213 1:14924352-14924374 CCGGGCACCCGGCATGCGGGCGG + Intronic
903078021 1:20787057-20787079 CGGGGCGCCCGGGTCCCCGGAGG - Intronic
904467919 1:30718983-30719005 CCGGGCTCCCGGAAGCCCACGGG + Intronic
906324020 1:44833099-44833121 CCTGGCGCCGGGAATCCCTGTGG - Intronic
908473777 1:64470001-64470023 CCCGGCCCCCGGCGTCCCGGGGG + Intergenic
912419360 1:109532693-109532715 CCGGGCGCCCAGAAACCCCAGGG + Intergenic
912659569 1:111515835-111515857 CCCGGCTCCCGGAGTTCCGGAGG - Intronic
918064414 1:181089584-181089606 CCGGGCGCCGGGCAGCCCGCTGG - Exonic
923463863 1:234231427-234231449 CCGGGCCCGGGGAGTCCCGGGGG - Exonic
1062978185 10:1700648-1700670 GCGAGCGCCCGGTCTCCCGGTGG - Intronic
1067443766 10:46327804-46327826 CCGGCTGCCTGGAATCCCAGGGG - Intronic
1067462126 10:46465809-46465831 CAGCGCGCCCGGCTTCCCGGAGG + Exonic
1067625069 10:47918789-47918811 CAGCGCGCCCGGCTTCCCGGAGG - Intergenic
1068953831 10:62804707-62804729 CCGGGCGCCCGGGGACCCTGCGG - Intergenic
1072705185 10:97675840-97675862 CCAGGGGCCCAGAATGCCGGGGG + Exonic
1075437308 10:122454599-122454621 CAGGGCGCCCTGACTCCTGGGGG + Intergenic
1077185477 11:1233715-1233737 GCGGGGGCTCGGAAGCCCGGGGG + Intronic
1077228573 11:1448822-1448844 CCTGGCTCCCGGACACCCGGGGG - Intronic
1077326927 11:1967955-1967977 CCGGCTTCCCGGCATCCCGGCGG - Intronic
1077628808 11:3797222-3797244 CCGGGGGCCCGGAGCCCGGGAGG - Intronic
1081774094 11:45665804-45665826 CCGGCCGCCCGAAGTCCGGGTGG - Intergenic
1081969203 11:47186455-47186477 CCGGGGGCCGGGCTTCCCGGGGG - Intergenic
1081969447 11:47187443-47187465 CCGGGCGCGCAGAATCGCAGCGG + Intergenic
1202809909 11_KI270721v1_random:23135-23157 CCGGCTTCCCGGCATCCCGGCGG - Intergenic
1091616406 12:2053753-2053775 CGGAGCGCCCGGGAGCCCGGCGG + Intronic
1096475532 12:51907056-51907078 CCCGGCGCCCCGATTCCAGGCGG + Intronic
1102028280 12:109725885-109725907 CCGGGCGCCCGGGAACACTGTGG - Intronic
1102254109 12:111406206-111406228 CCGGGCCCTCGAAATCCCGAGGG - Exonic
1105512251 13:21060998-21061020 CGGGGCGGCCGGGATCCCGGCGG - Intronic
1107966869 13:45605050-45605072 CCCGGCCCCTGGAATCCCTGAGG + Intronic
1113946728 13:114048643-114048665 CCCTGCGCCTGGAATCCCGAAGG + Intronic
1117675598 14:58152124-58152146 GCGGGCGCTCGGCATCCCAGCGG + Exonic
1119744255 14:77033153-77033175 CCGCGCGCCAGGAACCCCAGAGG + Intergenic
1121137201 14:91509887-91509909 CCCGGCGCCCGGCAGCCCCGAGG + Exonic
1122952107 14:105050764-105050786 CTGGGCTCCCGGAAGCCTGGAGG + Exonic
1123094940 14:105762584-105762606 CAGGGCACCCGGAAGCCCGTAGG + Intergenic
1123735674 15:23180285-23180307 CATGGCGCCCGGACTCTCGGAGG + Intergenic
1124286389 15:28403268-28403290 CATGGCGCCCGGACTCTCGGAGG + Intergenic
1124296314 15:28508368-28508390 CATGGCGCCCGGACTCTCGGAGG - Intergenic
1129193658 15:73951987-73952009 TCTGGCGTCCGGAATCCCTGTGG - Exonic
1132099822 15:99015250-99015272 CCCGGCGCCCGGTGTCCCCGGGG - Intergenic
1132515180 16:362854-362876 CCCGGCGCCCAGAGTCCTGGGGG - Intergenic
1132515196 16:362897-362919 CCCGGCGCCCAGAGTCCTGGGGG - Intergenic
1132515212 16:362940-362962 CCCGGCGCCCAGAGTCCTGGGGG - Intergenic
1132915131 16:2340110-2340132 CCGCGCGCCCGGCATCCCTGCGG + Intronic
1135691377 16:24540090-24540112 CCGGTCGTCCGGAAGCCAGGAGG + Intronic
1136459441 16:30400504-30400526 CGGGGCGCCGGGAAATCCGGCGG - Intergenic
1136932495 16:34431997-34432019 CCGGACGCCAGGAGTCGCGGAGG + Intergenic
1136972077 16:34979817-34979839 CCGGACGCCAGGAGTCGCGGAGG - Intergenic
1136989594 16:35143932-35143954 CCGGACGCCAGGAGTCGCGGAGG + Intergenic
1141695018 16:85615016-85615038 GCGGGAGCACGGAATCCCAGAGG - Intronic
1142631561 17:1229357-1229379 CGGGGCGCCCGGGGTCCCCGCGG + Intergenic
1144021331 17:11241608-11241630 CCGGGCGCCCGGAATCCCGGAGG + Exonic
1144746868 17:17621746-17621768 CCGGGTGCCTGGAACCCAGGGGG - Intergenic
1146567122 17:33923095-33923117 CCGAGCTCCAGGAATCCCGCAGG - Intronic
1151579339 17:74969314-74969336 GCAGGCGCCTGTAATCCCGGGGG - Intronic
1151928029 17:77213093-77213115 CCGGGTGCTGGGAAGCCCGGAGG - Intronic
1160791800 19:926697-926719 CCGGGCGCCCGGTTCCTCGGCGG + Intronic
1162818209 19:13208595-13208617 CCGGCCGCCGGGCACCCCGGTGG + Intronic
1165621431 19:37251872-37251894 CCGGGCTCCCGGAAACGTGGGGG - Intergenic
1167781510 19:51601724-51601746 CCGGGCGCGTCGGATCCCGGCGG - Intergenic
926018534 2:9474819-9474841 CCGGGCCCGCGGCGTCCCGGAGG + Intronic
928093790 2:28392252-28392274 CCCGGCTCCCGGCCTCCCGGTGG + Intergenic
929542654 2:42834245-42834267 CCAGGCCCCAGGAAGCCCGGAGG - Intergenic
938381062 2:130836926-130836948 CCGGGCTCCGGGCGTCCCGGCGG + Intronic
940639537 2:156332534-156332556 CCCGGCGCCCGGGCTCCCAGAGG - Exonic
946321948 2:218959696-218959718 CCGGGCGCGCGGACTGGCGGGGG - Exonic
947743445 2:232495634-232495656 CCGGGGGCCGGGAATCTTGGGGG + Intergenic
1171427416 20:25057626-25057648 CGGGGCGGACGGAATACCGGAGG + Intronic
1172993065 20:39050153-39050175 CCCGGTTCCGGGAATCCCGGTGG - Intergenic
1175466063 20:59191942-59191964 CAGGGCGCACGGCTTCCCGGCGG - Exonic
1176260432 20:64176698-64176720 CCGGGTGCCCGGAACCCAGGCGG - Intronic
1178695747 21:34792032-34792054 CCCAGGGCCCGGGATCCCGGCGG + Exonic
1179495501 21:41768971-41768993 CTGCGCTCCCGGAATCCCAGAGG - Intergenic
1185038055 22:48489878-48489900 TCGAGCGCCCGGAACCCGGGTGG - Intronic
1185359140 22:50394773-50394795 GCGGGCGCCCGTAGTCCCAGAGG + Intronic
964406433 3:156353518-156353540 CTGGGCACCAGGAATCCAGGTGG + Intronic
969671356 4:8592071-8592093 CCAGGCGCCCCAGATCCCGGGGG + Intronic
975552856 4:75630860-75630882 CCGGGCGCCCTGAGTCGCGTAGG + Intergenic
982712178 4:158768869-158768891 CCGGGCTCACGTAACCCCGGCGG - Intergenic
987050349 5:14143373-14143395 GCCGGCGCCCGTGATCCCGGAGG + Intergenic
992690585 5:79236884-79236906 CCGCGGGCCCGGCAGCCCGGCGG + Exonic
994353400 5:98770475-98770497 ACGGGCCCCCGCAATCCCTGCGG - Intronic
997129582 5:131263842-131263864 CCGCGCGGCTCGAATCCCGGGGG + Intronic
1001678295 5:173536624-173536646 CCGGGGGCCCCTCATCCCGGGGG + Intergenic
1002526068 5:179816859-179816881 CCGGGTGGCCGGAGACCCGGGGG - Intronic
1003942528 6:11043895-11043917 CCGGGCGCCCGGGATGCCCGAGG - Intronic
1025231011 7:57203347-57203369 TCAGGCGCACGGAAGCCCGGCGG - Intergenic
1025239103 7:57256744-57256766 CTGGACGCCCGGGCTCCCGGCGG + Intergenic
1025730000 7:64100477-64100499 GGAGGCGCCCGGAAGCCCGGCGG + Intronic
1027421195 7:78019620-78019642 CAGGGCGCCCGGGCTCGCGGCGG - Exonic
1034659849 7:152759743-152759765 CCGGGAGCCCGGATGCTCGGCGG - Exonic
1034976972 7:155454510-155454532 CCGGGCGCCCGGTGTCTCCGGGG + Intergenic
1040928902 8:52714202-52714224 GCGGGCGCCCGGGACGCCGGCGG - Exonic
1045222586 8:100213288-100213310 CCCGCCGCCCGGATGCCCGGTGG - Exonic
1049676552 8:143891809-143891831 CGGGGTGCCCAGCATCCCGGGGG + Intergenic
1051171568 9:14322704-14322726 CAGGGCGCCCGGGACCCGGGAGG + Intronic
1052362167 9:27573229-27573251 CCGGGCCCCGGGCTTCCCGGCGG - Intronic
1053129154 9:35605516-35605538 CCGGGCGCCCGGGATCGGGCTGG + Exonic
1055308209 9:74952253-74952275 CCGGGCGCCCGGCTCCCGGGGGG - Exonic
1056710824 9:88991128-88991150 CCGGGCGCCCAGAGACCCAGCGG - Exonic
1056773908 9:89497963-89497985 TCGGGCGCCAGGAATGGCGGCGG + Intronic
1061006352 9:127930557-127930579 CGGGGCGCCAGGTATCCCGAGGG - Intronic
1061478394 9:130884306-130884328 CTGAGCCCCCGGACTCCCGGAGG - Exonic
1062461814 9:136665553-136665575 TCGGGCCCCAGGATTCCCGGAGG + Intronic
1062529175 9:136992417-136992439 CCGGGCGAGCGGGAACCCGGCGG - Exonic
1194666778 X:96684888-96684910 CTGGGAGCCTGGAGTCCCGGGGG + Exonic
1197335045 X:125203165-125203187 CAGGGAGCCCGGGTTCCCGGGGG - Intergenic
1198683353 X:139204332-139204354 CCGGCCGCTCGGGATCGCGGCGG - Intronic