ID: 1144022927

View in Genome Browser
Species Human (GRCh38)
Location 17:11252766-11252788
Sequence CCACATGCCCTGTCGCTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144022927_1144022932 11 Left 1144022927 17:11252766-11252788 CCCTGCAGCGACAGGGCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1144022932 17:11252800-11252822 GCTGAGGCTGCTCCAGAACTTGG 0: 1
1: 0
2: 4
3: 28
4: 253
1144022927_1144022936 23 Left 1144022927 17:11252766-11252788 CCCTGCAGCGACAGGGCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1144022936 17:11252812-11252834 CCAGAACTTGGGGAAGAATCTGG 0: 1
1: 0
2: 2
3: 22
4: 216
1144022927_1144022933 12 Left 1144022927 17:11252766-11252788 CCCTGCAGCGACAGGGCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1144022933 17:11252801-11252823 CTGAGGCTGCTCCAGAACTTGGG 0: 1
1: 0
2: 2
3: 27
4: 252
1144022927_1144022931 -5 Left 1144022927 17:11252766-11252788 CCCTGCAGCGACAGGGCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1144022931 17:11252784-11252806 TGTGGCTGGCTCAAAAGCTGAGG 0: 1
1: 1
2: 5
3: 25
4: 200
1144022927_1144022934 13 Left 1144022927 17:11252766-11252788 CCCTGCAGCGACAGGGCATGTGG 0: 1
1: 0
2: 1
3: 9
4: 147
Right 1144022934 17:11252802-11252824 TGAGGCTGCTCCAGAACTTGGGG 0: 1
1: 0
2: 2
3: 21
4: 307

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144022927 Original CRISPR CCACATGCCCTGTCGCTGCA GGG (reversed) Intronic
900922248 1:5680521-5680543 ACACATGCCCTGTGGCAGCCTGG + Intergenic
901189925 1:7403684-7403706 CCACCAGCCCTATGGCTGCAGGG + Intronic
902310441 1:15577863-15577885 CCTCAGTCCCTGTCTCTGCAGGG - Exonic
903682032 1:25103591-25103613 CCACATGCCCTGAGGCTGAAAGG + Intergenic
905243508 1:36596636-36596658 TCACAAGCCCTGTGGCTGCCTGG + Intergenic
906144319 1:43550913-43550935 GCAAAGGCCCTGTGGCTGCAGGG + Intronic
906665895 1:47621803-47621825 CCACAGACCCTGAGGCTGCAGGG + Intergenic
911359835 1:96862784-96862806 CCACATCCCCACTGGCTGCATGG - Intergenic
914393640 1:147243525-147243547 CCCCCAGCCCTGCCGCTGCATGG + Intronic
922169534 1:223143166-223143188 GCCCATCCCCTGCCGCTGCAGGG + Intronic
923886722 1:238165285-238165307 CCACATGCTCTCTCAGTGCATGG + Intergenic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1063386380 10:5618886-5618908 CCACATGCCCGGGCCCTGGAAGG + Intergenic
1067791740 10:49293487-49293509 CCACACCCACTGTGGCTGCAGGG - Intergenic
1071473161 10:86001594-86001616 ACAGATGCCCTTTCTCTGCAAGG - Intronic
1075672372 10:124271199-124271221 CTACATTCCCTGTAGCTGCATGG - Intergenic
1076014296 10:127015374-127015396 CCAGGAGCCCTGTGGCTGCATGG + Intronic
1076166721 10:128287975-128287997 CCACATACCCCGGCCCTGCAAGG - Intergenic
1076184023 10:128432574-128432596 CCACAAGCCCTGTTGCTGCAGGG + Intergenic
1076454351 10:130579059-130579081 CCACATCCCCTATGGCTGGAGGG - Intergenic
1076575306 10:131462103-131462125 TCACGTACCCTGTCTCTGCATGG + Intergenic
1076796895 10:132802845-132802867 TCTCAGGCCCTGTCCCTGCAGGG + Intergenic
1077777831 11:5291321-5291343 CCAGATGTCCTGTCCCTGTAAGG + Intronic
1082146396 11:48675564-48675586 CCAAATGCCCATTCGCTGAATGG - Intergenic
1082264441 11:50104386-50104408 CCACTTTCCCTGTGGCTGCCTGG - Intergenic
1082794791 11:57371135-57371157 CCACATGTCCTGGCCCTTCAGGG + Intergenic
1084641661 11:70429958-70429980 CCCCAGGCCCTGCCCCTGCAGGG + Intronic
1084693811 11:70742162-70742184 CCACATCCCCTGTGGCCTCATGG + Intronic
1085466740 11:76729142-76729164 CCTCATGTCCTGTAGGTGCAGGG - Intergenic
1086584199 11:88432856-88432878 CAACTTGCCCTGTAGCTGGATGG - Intergenic
1088926518 11:114308396-114308418 CCTCCTGCCCTGTCTCAGCAAGG - Intronic
1091338909 11:134795244-134795266 ACGCATTCCCTGTCTCTGCAGGG - Intergenic
1091831575 12:3554143-3554165 CCACGAGCCCTGTCACTGCTGGG + Intronic
1092041948 12:5393074-5393096 CCTCCTGCCCTGTGGCTGTACGG + Intergenic
1095951557 12:47784465-47784487 TCTCATCCCCTGTGGCTGCAAGG + Intronic
1102354392 12:112220822-112220844 GCACCTGCCCTGGCCCTGCATGG + Intronic
1102709626 12:114914736-114914758 CTACATGCCTTGTATCTGCAGGG + Intergenic
1103322902 12:120102081-120102103 CCACCTGCCCAGTCGATGCAGGG + Intronic
1103592770 12:122004152-122004174 CCTCATTCCCTTTCCCTGCAGGG + Intergenic
1104850119 12:131868695-131868717 CCACATCCCAGGTCCCTGCAGGG + Intergenic
1105818900 13:24062476-24062498 CCACCAGCCCTGCCGCTCCAGGG + Intronic
1108643725 13:52406528-52406550 CCACATGCTGTGCCGCTTCAAGG - Intergenic
1109693088 13:65918752-65918774 CCACATGGCCTCTCTCTGTATGG + Intergenic
1110263723 13:73515044-73515066 TCACATGCCCTGAAGCTGCTGGG + Intergenic
1111580098 13:90211493-90211515 CCACATGCCCTGCCACAGCATGG - Intergenic
1113329407 13:109314182-109314204 CCACGAGCCCCATCGCTGCAGGG - Intergenic
1113859895 13:113474684-113474706 CCTCATGCCCTGTCACCGCAGGG - Intronic
1113899752 13:113789747-113789769 CCACATGCCCGGTCAGTCCAGGG - Intronic
1114569726 14:23658163-23658185 CCACATCTCCAGTCGCAGCACGG + Intergenic
1117189405 14:53275733-53275755 CCACATGGCCTGGCTCTACATGG + Intergenic
1121317298 14:92969915-92969937 CCACGTGCCCTCCCGCTTCATGG - Intronic
1122951344 14:105046910-105046932 CCACATGCCAGGAGGCTGCAGGG + Intergenic
1123895896 15:24829508-24829530 CCCCATGCCCAGTCCCTGCATGG - Intronic
1123932439 15:25178350-25178372 CCACCTGCCCTGTCCTTCCATGG + Intergenic
1123935684 15:25192936-25192958 CCACCTGCCCTGTCCTTCCAGGG + Intergenic
1123942198 15:25221987-25222009 CCACTTGCCCTGTCTTTCCAGGG + Intergenic
1123944820 15:25233890-25233912 CCGCTTGCCCTGTCTCTCCAGGG + Intergenic
1123946065 15:25239478-25239500 CCACTTGCCCTGTCTTTCCAGGG + Intergenic
1124319554 15:28702899-28702921 CCCCAGGCCCTGGGGCTGCAGGG + Intronic
1125908680 15:43416711-43416733 CCACATGCCATTTCACTTCACGG - Intronic
1126270823 15:46815060-46815082 CCTTATGTCCTGTAGCTGCAAGG - Intergenic
1128703224 15:69819571-69819593 CTAAATGCAGTGTCGCTGCAGGG + Intergenic
1133256924 16:4522775-4522797 CCCGCTGCCCTGTCCCTGCAGGG - Intronic
1136344429 16:29665714-29665736 ACCCTTGCCCTGTAGCTGCAAGG + Exonic
1137464097 16:48692336-48692358 CCACATATCCTGTCACTGCATGG + Intergenic
1141940666 16:87274009-87274031 CCACATGCTCTGTGGCTTTAGGG - Intronic
1142266997 16:89068597-89068619 CCACATGCACTGTCGTATCAGGG + Intergenic
1144022927 17:11252766-11252788 CCACATGCCCTGTCGCTGCAGGG - Intronic
1144179077 17:12734974-12734996 CCCCCTGCCCTGTCCTTGCACGG + Intronic
1144785794 17:17830892-17830914 CCACATGGCCCGTGGCTGCTAGG + Intronic
1144944859 17:18964669-18964691 GCTCTTGCCCTGTGGCTGCAAGG - Intronic
1145006808 17:19343013-19343035 CCACATGCCATCCTGCTGCACGG + Intronic
1146716849 17:35093506-35093528 CCTCATGCCCTGGAGCTGTACGG - Intronic
1147548761 17:41423063-41423085 CTACAAACCGTGTCGCTGCAGGG - Intronic
1150660587 17:67072687-67072709 CCAAAGGGCCTGTCGCTCCATGG + Exonic
1152047115 17:77944454-77944476 CCACATGGCCTGTTCCTACAGGG - Intergenic
1152685012 17:81689647-81689669 ACGCTTGCCCTGTGGCTGCAGGG + Intronic
1152738279 17:82008039-82008061 CCACATGCTGGGTGGCTGCAGGG + Intronic
1157729097 18:49988468-49988490 CCTTATTCCCTGTCTCTGCAAGG - Intronic
1161687633 19:5711273-5711295 CCACCTGCCCTCCCGCTGTAGGG - Intronic
925216307 2:2098616-2098638 CCCCCTGCCCTGTGTCTGCAGGG - Intronic
927371080 2:22355919-22355941 CCTCATTCCCTATCCCTGCAGGG + Intergenic
932114706 2:69035708-69035730 ACAGCTGCCCTGTCGCTGCTGGG - Intronic
934479956 2:94628120-94628142 CCACATGCTATGTCACAGCAAGG + Intergenic
934970257 2:98757761-98757783 CCACAAGCCCTGGAGATGCAGGG - Intergenic
939350586 2:141032992-141033014 CCCCATCCCCTGTTGCTGCCTGG - Intronic
941806208 2:169713926-169713948 CCACATGGCCTGGCCCTACATGG + Intronic
944880793 2:204011080-204011102 CCCCATCCCATGTGGCTGCAGGG + Intergenic
1168788382 20:559065-559087 GCACATGCACTGTGACTGCATGG + Intergenic
1170373957 20:15679645-15679667 CCACATGGTCTGTTGCAGCAGGG - Intronic
1172809550 20:37637445-37637467 CCACACGCCCTGCCTCTGCCTGG + Intergenic
1173703447 20:45093308-45093330 CCGCCTGCCCTGTCCCTGCTTGG - Exonic
1174173429 20:48630699-48630721 CCACGTGCCCTCCTGCTGCAGGG - Intronic
1177089066 21:16743451-16743473 CCACATTCCCAGAAGCTGCAGGG + Intergenic
1179376943 21:40857987-40858009 GCACATGCCATGCCTCTGCAAGG - Intergenic
1179493422 21:41756302-41756324 CCACACGCCATGTAGCTGGAGGG - Intronic
1181147623 22:20859799-20859821 CCACCTGCCCTGATGCTTCAGGG - Intronic
1182648464 22:31829790-31829812 CCAACTGCCCTGTCTCTGCTGGG - Intronic
1183312732 22:37119826-37119848 CCACATGCCCTTGAGCTACAAGG + Intergenic
1184206246 22:43005525-43005547 CCTCCTGCCCTGGCCCTGCATGG - Intronic
1184729658 22:46365595-46365617 CCTCATGCCCAGGAGCTGCAAGG - Exonic
950550829 3:13664925-13664947 GGACAGGCCCTGTCGCTGGAGGG + Intergenic
952567581 3:34677960-34677982 CCAGAAGCCCTGTAGCTGAATGG - Intergenic
953340543 3:42130877-42130899 CCACATACCCTGGCTGTGCAAGG - Intronic
954148452 3:48645867-48645889 CTAACTGCCCTGTGGCTGCAGGG - Exonic
954385223 3:50240570-50240592 CCCCATAACCTGTGGCTGCAGGG - Intronic
961765255 3:129205523-129205545 CCACAGCCCATGTGGCTGCAGGG - Intergenic
963142671 3:141960544-141960566 CCCCAAACCCTGTCCCTGCAGGG - Intronic
964585051 3:158288541-158288563 TCACATGCCCTTTCCCTGCCTGG + Intronic
970446035 4:16124048-16124070 CCACATGCCCTGAGGCTACAAGG + Intergenic
981418548 4:144521651-144521673 CCACATACCCTGTCCTTGCCTGG + Intergenic
984864499 4:184270190-184270212 CCACATACCCTGCAGCTGAATGG + Intergenic
985609141 5:877028-877050 CCGCCTGCCTTGTGGCTGCAGGG - Intronic
985884749 5:2668832-2668854 CCAGAGGCCCTGCCTCTGCAGGG + Intergenic
995437985 5:112159404-112159426 CCACTTGTCCTGTCCCTTCAAGG + Intronic
997702304 5:135911296-135911318 TCACAGGGCCTGTGGCTGCAAGG + Intergenic
1001957455 5:175857962-175857984 GCACAGGCCCTGGCGCTGCTGGG - Intronic
1002415626 5:179119543-179119565 ACACAGGCCCTGTGGCTGCCTGG + Intronic
1002548196 5:179966769-179966791 CCACATGCCCTGTGCCTGAGCGG + Intronic
1003252947 6:4448023-4448045 CCCCATGCCTTGTCCCTGTATGG - Intergenic
1003266406 6:4568354-4568376 CCACATGCCGTGAGGCTGGAGGG - Intergenic
1005696187 6:28354808-28354830 CCACATGGCCTGGCCCTACATGG + Intronic
1009712996 6:67348393-67348415 CCACATGCCCTGGCCCCACATGG - Intergenic
1009908941 6:69903004-69903026 CCACATGGCCTGGCCCTACATGG + Intronic
1012999782 6:106010744-106010766 CCACGTGCCCTGTCGTGTCAGGG + Intergenic
1016686908 6:146892067-146892089 CCACATACCCTGTCCCTCCAGGG - Intergenic
1017709227 6:157151085-157151107 CCTCAGGCCCTGTCTGTGCATGG + Intronic
1017815141 6:158010943-158010965 CCACATGTCCTGTCGTCCCAAGG - Intronic
1017854729 6:158340400-158340422 CCTCCTGCCCTGACGCTGCTTGG + Intronic
1019033207 6:169031398-169031420 CCTCCTGCCCTGTGGCTGAAGGG + Intergenic
1024178508 7:46864218-46864240 TCCCATGCCCTGTGGCTGCCAGG + Intergenic
1024221164 7:47288291-47288313 CCACACGCCCTGTGGGTGAAGGG + Intronic
1025981432 7:66410461-66410483 CCACTTTCCCTGTGGCTGCCTGG - Intronic
1028501132 7:91520191-91520213 TCACATTCCCTGCCTCTGCATGG + Intergenic
1029688748 7:102166391-102166413 CCAGTGGCCCTGTCTCTGCAGGG + Intronic
1038533734 8:28339132-28339154 CCACATGCTCTGGGGCGGCAGGG - Exonic
1038537015 8:28360745-28360767 CCAGGTGCCCTGTGGCTGGAGGG + Intronic
1039581733 8:38672254-38672276 CCTCATCTCCTGTCCCTGCATGG + Intergenic
1041004616 8:53486468-53486490 CCACATGGCCTGGCCCTACATGG - Intergenic
1045557239 8:103226279-103226301 CCACAAGCCATTTAGCTGCATGG - Intronic
1047666164 8:127093816-127093838 CCACTTGATCTGTCCCTGCAAGG + Intergenic
1049594269 8:143476241-143476263 CCCCATGCCCTCTCAGTGCAGGG - Intronic
1049740921 8:144240476-144240498 CCCCATGTGCTGTGGCTGCAGGG - Intronic
1053677886 9:40455681-40455703 CCACATGCTATGTCACAGCAAGG - Intergenic
1053927801 9:43083512-43083534 CCACATGCTATGTCACAGCAAGG - Intergenic
1054285843 9:63169274-63169296 CCACATGCTATGTCACAGCAAGG + Intergenic
1054290959 9:63291207-63291229 CCACATGCTATGTCACAGCAAGG - Intergenic
1054388980 9:64595754-64595776 CCACATGCTATGTCACAGCAAGG - Intergenic
1054506737 9:65920617-65920639 CCACATGCTATGTCACAGCAAGG + Intergenic
1056951729 9:91045481-91045503 CAACATGCCCTGCAGCTGCCAGG + Intergenic
1057218169 9:93241024-93241046 AAACATGCCCTATCCCTGCAGGG - Intronic
1057437576 9:95056385-95056407 TCACAGGCCCTGCCTCTGCAAGG + Intronic
1060154808 9:121312268-121312290 CCCCAAGCCCTGTCGCTGGGCGG + Intronic
1186107311 X:6221558-6221580 CCTCATGCCCTGAAGCTACATGG - Intronic
1186349325 X:8727344-8727366 ACCCATGCCCGGTCCCTGCAGGG - Intronic
1191057639 X:56259010-56259032 CCAAATGCTCTTTCACTGCATGG - Intronic
1200119882 X:153785182-153785204 CCACATGGCCTGAGGCTGCCCGG - Intronic
1200119886 X:153785190-153785212 CCTCAGGCCATGTGGCTGCAGGG + Intronic