ID: 1144027715

View in Genome Browser
Species Human (GRCh38)
Location 17:11293145-11293167
Sequence AGGTTTTTCCAGTTGCTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 185
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 175}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144027709_1144027715 12 Left 1144027709 17:11293110-11293132 CCACTGCGCCCGGCCTCCAGATT 0: 2
1: 12
2: 186
3: 1246
4: 6689
Right 1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG 0: 1
1: 0
2: 2
3: 7
4: 175
1144027712_1144027715 -1 Left 1144027712 17:11293123-11293145 CCTCCAGATTGATATTTTTGAAA 0: 1
1: 0
2: 5
3: 61
4: 482
Right 1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG 0: 1
1: 0
2: 2
3: 7
4: 175
1144027714_1144027715 -4 Left 1144027714 17:11293126-11293148 CCAGATTGATATTTTTGAAAGGT 0: 1
1: 0
2: 2
3: 40
4: 451
Right 1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG 0: 1
1: 0
2: 2
3: 7
4: 175
1144027710_1144027715 4 Left 1144027710 17:11293118-11293140 CCCGGCCTCCAGATTGATATTTT 0: 1
1: 0
2: 8
3: 62
4: 491
Right 1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG 0: 1
1: 0
2: 2
3: 7
4: 175
1144027711_1144027715 3 Left 1144027711 17:11293119-11293141 CCGGCCTCCAGATTGATATTTTT 0: 1
1: 0
2: 4
3: 45
4: 473
Right 1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG 0: 1
1: 0
2: 2
3: 7
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144027715 Original CRISPR AGGTTTTTCCAGTTGCTGTA TGG Intronic
900334666 1:2156188-2156210 AGGTTCTCCCAGTTGCTGTACGG + Intronic
905188435 1:36214073-36214095 AGTTTTTTCCTGTTTCTGTTAGG - Intergenic
914743884 1:150487032-150487054 AAGTTTTGCTACTTGCTGTAAGG + Intergenic
916866890 1:168869415-168869437 ATGTTTCTGGAGTTGCTGTATGG - Intergenic
918034693 1:180856485-180856507 AGTTTTTTCCAGTTGTTTTCTGG + Intronic
919399409 1:197092490-197092512 AGCTTTCTACAGTTGCTGTTGGG + Intronic
924771260 1:247081948-247081970 GTGTTTTTCCATTTGCTTTATGG + Intergenic
1062783421 10:238732-238754 AGGATTTACCAGTTACTTTAAGG - Intronic
1063028347 10:2205747-2205769 ATGTGTTTCTAATTGCTGTATGG - Intergenic
1065461451 10:25969547-25969569 ATTTTTTACCAGTTGCTTTAGGG - Intronic
1066797178 10:39135379-39135401 AGTTTTTTCTAGTTTTTGTATGG - Intergenic
1067482541 10:46613073-46613095 AGTTTTTTCCAGTAACTGTTAGG - Intergenic
1067612210 10:47728591-47728613 AGTTTTTTCCAGTAACTGTTAGG + Intergenic
1069851443 10:71407728-71407750 AGTTTTATCATGTTGCTGTATGG + Intronic
1070347219 10:75556508-75556530 AGGTTCTTCCAGTTGAAGAATGG + Intronic
1071314069 10:84374789-84374811 ACGATTTTCCAGTAGTTGTATGG + Intronic
1073122303 10:101130261-101130283 ACGTTTTGCCAGTGGCTGTCTGG - Intronic
1074630825 10:115252917-115252939 AAGTTTTTGCAGTTGCTTAATGG + Intronic
1074734209 10:116411438-116411460 AGGTTTTTTCAGTTGATATTCGG - Intergenic
1076564447 10:131388610-131388632 AGGTTTTTCTAGAAGCTGTGGGG + Intergenic
1076933572 10:133551847-133551869 AGGTTTTTCAAGTTGGTATAAGG + Intronic
1079356614 11:19735240-19735262 AGGTGTTCCCAGTTGCAGGATGG + Intronic
1080296238 11:30732127-30732149 AAGTTTTTCAAGTTGCAGTCAGG - Intergenic
1080712974 11:34769326-34769348 AGGTGCTTGCAGTTGCTGTGGGG + Intergenic
1082573827 11:54778144-54778166 AGTTTTTTCCATTTGTTGAATGG + Intergenic
1085008597 11:73118619-73118641 AGGTTTTTCTTTTTGGTGTAAGG + Intronic
1085502522 11:77037164-77037186 AGGTTTTTCCAGCTGCGGGAGGG + Intronic
1087596337 11:100258820-100258842 ATGTTTTTGCAGAGGCTGTATGG - Intronic
1087609994 11:100422644-100422666 AGCTTTCTGCAGCTGCTGTAGGG - Intergenic
1089151964 11:116371312-116371334 AGGTCATTCAAGTTGCTGTTGGG - Intergenic
1089556844 11:119319845-119319867 AGGTGTTTGCAGCTGCTGTGAGG + Intronic
1093719196 12:22418765-22418787 TGGTCTTTCCAGATGCTCTAGGG - Intronic
1093719695 12:22425405-22425427 TGGTCTTTCCAGATGCTCTAGGG - Intronic
1102855233 12:116287852-116287874 ATGTGTTTCCAGTTGTTGCATGG - Intergenic
1103571369 12:121847200-121847222 AGGTTTTTCAGGTACCTGTAGGG + Exonic
1104287745 12:127440415-127440437 AAGTTTTGGCAGATGCTGTATGG - Intergenic
1105506495 13:21014610-21014632 AGCTTGTTTCAGTTGCTGCATGG - Intronic
1106080056 13:26492816-26492838 AGGTGATTCCAGCTGCTGTGTGG - Intergenic
1107349400 13:39498797-39498819 AGGTTTTTGTAGTTGCTGGTGGG - Intronic
1107494768 13:40915476-40915498 ATGTCTTTCTGGTTGCTGTATGG + Intergenic
1107852882 13:44588561-44588583 AGGTATTTACAATTGTTGTAGGG - Intergenic
1107939632 13:45372410-45372432 AGGTTGGTCAAGCTGCTGTAAGG + Intergenic
1109215811 13:59588640-59588662 AGGTTTTTAAAGTAGCTGGAAGG - Intergenic
1109572407 13:64210324-64210346 AGGTTTCCCCAGTGGCTTTATGG - Intergenic
1110593974 13:77297500-77297522 AGGTTGTTCCAGATGCTGAAGGG + Intronic
1111012081 13:82326463-82326485 AGGTTTTTCAAGGTGCTATCTGG - Intergenic
1111252094 13:85614856-85614878 AGGTTATTGAAGTTGCTGTTAGG + Intergenic
1112999172 13:105612375-105612397 GGGTTTTCCCATTTTCTGTATGG + Intergenic
1113511602 13:110859811-110859833 AGGTTTTTCCTGGTGCAATAAGG - Intergenic
1113609691 13:111635249-111635271 AGGTTCTTTCAGTAGCTGAAAGG - Intronic
1114484401 14:23054437-23054459 AGGTTTCTCCAGACACTGTAGGG + Intronic
1114731774 14:25000597-25000619 AGGTTTTTTGGGTGGCTGTAGGG - Intronic
1116596408 14:46852672-46852694 AGGTTTTTCCATGTGGTGGATGG - Intronic
1120126020 14:80744529-80744551 ATGTTTCTTCATTTGCTGTATGG - Intronic
1121476245 14:94207386-94207408 AGGCTTTTTCTGTTGCTATACGG - Intronic
1125416047 15:39453650-39453672 AGACTTTCCCAGTTGCTGTTTGG - Intergenic
1126780553 15:52135624-52135646 AGGTGTTTCCAGTTTCTGAGGGG + Exonic
1131917577 15:97286920-97286942 AGGTTTTTCAAGATTCTGTAGGG - Intergenic
1133788945 16:8994394-8994416 AGGTTTTGCAAGATGCTATAAGG + Intergenic
1135893819 16:26380399-26380421 AGGTTTCCCCAGTTGCCTTACGG + Intergenic
1136587981 16:31200139-31200161 AGGTCTTTCCAGAGGCTGTTTGG - Intergenic
1136927071 16:34384297-34384319 AGGGCTTTCCAGTTACTGAATGG - Intergenic
1136977503 16:35027510-35027532 AGGGCTTTCCAGTTACTGAATGG + Intergenic
1137002081 16:35237946-35237968 AGTTTTTTCCAGGTGTTTTATGG - Intergenic
1137011594 16:35327107-35327129 AGCTTTTTCCAGTTGCTTTATGG - Intergenic
1137018402 16:35398097-35398119 AGTTTTTTTCAGTTGCTTCATGG - Intergenic
1137406460 16:48193125-48193147 GGGTTTTTCCAGAGGCTGGAAGG + Intronic
1139224753 16:65223471-65223493 TGGTTTCTGCAGTTGCTGTGGGG - Intergenic
1139957862 16:70701640-70701662 AGGATTGTCCAGTTGGTGTGTGG - Intronic
1144027715 17:11293145-11293167 AGGTTTTTCCAGTTGCTGTATGG + Intronic
1144400312 17:14891454-14891476 CTGTTTTACCAATTGCTGTAGGG - Intergenic
1150525192 17:65915464-65915486 AGATCTCTCCAGTTGCTGTGTGG - Intronic
1151132576 17:71912876-71912898 AGGTTTTTCTAGGAGCTGTTAGG - Intergenic
1151404628 17:73878410-73878432 AGGTTTTTCCATTTGCAAAATGG - Intergenic
1152012932 17:77730003-77730025 AGGTCTTTCCACTGGCTGTTGGG - Intergenic
1152535336 17:80947598-80947620 AGGCTTTTCCTGGTGCTGGAAGG - Intronic
1154412159 18:14147286-14147308 AGGTGTTTCCAGTTGCGTGAGGG - Intergenic
1155505037 18:26525114-26525136 AGATTTTTAAAGTTGCTGTTTGG - Intronic
1155610003 18:27655981-27656003 AGGTTTTTCGGGTCACTGTAGGG + Intergenic
1156807294 18:41200699-41200721 TGGTTATTCCATTTGCAGTAAGG + Intergenic
1156943614 18:42799552-42799574 AGATTACTCCAGTTGCTGAAAGG - Intronic
1157671496 18:49532885-49532907 AGGTCTTTTCATTTGCTGTTTGG + Intergenic
1157866205 18:51187178-51187200 AGGGTTTTCCAGATTATGTAAGG - Intronic
1160574745 18:79846785-79846807 TGGTTTTTCCAGTTGTCGCATGG + Intergenic
1162599875 19:11660275-11660297 GGGTTTGTCCACTTCCTGTATGG + Intergenic
1163029334 19:14533953-14533975 CTGTTTTTCCAGTTGCTGCTGGG - Intronic
1163684927 19:18706643-18706665 AGGTTTTTTGAGATTCTGTATGG + Intronic
1166855509 19:45781036-45781058 AGGTTTTTCCAGAGGCTGAATGG + Intronic
1167400825 19:49267607-49267629 AGGTTTTTGGAGAGGCTGTAGGG + Intergenic
926856895 2:17266655-17266677 GGATTTTTCCAGTTTATGTAGGG - Intergenic
927797912 2:26067548-26067570 AGGTGTTGACAGTTGCTGGAAGG - Intronic
927893991 2:26769722-26769744 ACGTTTTTCCAGTAGCTTTCAGG + Intronic
928337728 2:30412492-30412514 AGATTTTTCCAGCTGCTTTCAGG - Intergenic
928482055 2:31692913-31692935 AGGTTTTCCAAGGTGCTGTCTGG + Intergenic
928845529 2:35667152-35667174 AGGTTTTTCAAATTTCTGAATGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
937008275 2:118538383-118538405 GGGGTTTTCCAGAGGCTGTATGG + Intergenic
937939276 2:127272623-127272645 AGGTTTTTCCAGTTCTTTTGGGG - Intronic
938565602 2:132515671-132515693 AGGTTTTATTAGTTGCTTTAAGG - Intronic
941183322 2:162288221-162288243 TGGTTTTTCCACTCCCTGTAGGG + Exonic
946087595 2:217189797-217189819 AAGTTTATCAACTTGCTGTAGGG + Intergenic
946266321 2:218545106-218545128 GGGTTATTTCAGTGGCTGTAGGG + Intronic
948072327 2:235137958-235137980 AGCTTTCTGCAGTTGCTGAAAGG + Intergenic
948175534 2:235939776-235939798 AGGTTTTTCCTGCTGCTCTCTGG + Intronic
1169541403 20:6603986-6604008 AGGTATGACCAGTTGCTGTGTGG + Intergenic
1173398900 20:42706726-42706748 AGGTATTTCAAGATTCTGTATGG - Intronic
1176860849 21:14010974-14010996 AGGTGTTTCCAGTTGCATGAGGG + Intergenic
1177234386 21:18368135-18368157 AGGTTTTTACAGATGCTTAAAGG - Intronic
1177314056 21:19433575-19433597 AGGTTTATCTACTTGCTGTGGGG - Intergenic
1178553672 21:33566418-33566440 AGTTTCTTCCACTTGCCGTAAGG + Intronic
1183394406 22:37562939-37562961 AAGTTTTTCCACTTTTTGTAAGG - Intronic
949668156 3:6365604-6365626 ATGTTTTTCATGTGGCTGTATGG + Intergenic
950492961 3:13317251-13317273 AGGATTGTCCAGTTACTTTAGGG - Exonic
952142099 3:30491427-30491449 AGGATTTTCAAATTGCTGCATGG - Intergenic
952687120 3:36162876-36162898 AGGTTTCTCCAGGAGCTGTGTGG + Intergenic
952754546 3:36855065-36855087 AGGTTTTTACAGCTGAAGTAAGG - Intronic
958896933 3:99839797-99839819 AGGTTTTTAAAGTTGCTTTGAGG + Intronic
960404985 3:117248807-117248829 ATTTTTTTCCATTGGCTGTAGGG - Intergenic
960820650 3:121727198-121727220 AGGGTTGTCCAGTTTTTGTATGG + Intronic
963881376 3:150532774-150532796 ATGTTTCTTCATTTGCTGTATGG - Intergenic
966072099 3:175891458-175891480 AGCTAGTTCCAGTTGCTGGAAGG + Intergenic
968377041 4:52335-52357 ACGGTTTCCCAGTTGCTGTTTGG - Intergenic
969949263 4:10817258-10817280 AAGGTTTTCCAGTTGCTCAATGG + Intergenic
972843334 4:42956899-42956921 AGGGGTTTCTCGTTGCTGTAGGG + Intronic
974720561 4:65732843-65732865 ACGTTTTTCCATCTGCTCTAGGG - Intergenic
976110119 4:81663898-81663920 AGGGTTTTCCAGTTTTTGTGGGG - Intronic
977567831 4:98598961-98598983 AGGATTTTCCTGTTGCTCTTTGG - Intronic
979835695 4:125364710-125364732 AGGTTTTTTCAGCTGGTGCATGG + Intronic
981130950 4:141157879-141157901 AGGTTATTGCATTTGCTCTATGG + Intronic
984893217 4:184512032-184512054 ATGCTTTTGCAGCTGCTGTAAGG + Intergenic
986588992 5:9349238-9349260 AGGTTTTTCCAGGAACTTTAGGG + Intronic
990008353 5:50967684-50967706 AGATTTTTCCAGCAGGTGTAAGG - Intergenic
993423159 5:87728094-87728116 AGTTTTTTCCAGTTTATGAAAGG + Intergenic
994633661 5:102318012-102318034 TTGTTTTTCCAGTTGTTTTATGG + Intergenic
995028445 5:107451284-107451306 TGATTTATCCAGTTGCTCTATGG - Intronic
995877009 5:116800913-116800935 AGATTTTTGCAGTTGCTATCAGG - Intergenic
1001087775 5:168713904-168713926 AGGTTTCTCCTATTGCTTTAAGG + Intronic
1003499256 6:6690752-6690774 GGGTTTATCCAGTTTCTGCAGGG - Intergenic
1004585826 6:16998960-16998982 AGGTCATTCCAGTTGCTGGTTGG - Intergenic
1008002986 6:46380140-46380162 AGGGTTTTTCAGATTCTGTAAGG + Intronic
1008217351 6:48809786-48809808 TGTTTTTTCCAGATGTTGTAAGG - Intergenic
1008807326 6:55446694-55446716 AACTTTTTCTTGTTGCTGTATGG + Intronic
1009758983 6:67979231-67979253 AGGTTCATCCAGTTTCTGCAGGG + Intergenic
1010604460 6:77871222-77871244 TGGTTTTGCCACTTGCTCTATGG - Intronic
1012573948 6:100767222-100767244 TGGTTTTTCCAGCTCCTGTAGGG + Exonic
1015307840 6:131730283-131730305 AGGTTTCTCCACTTGGTATAAGG - Intronic
1015551774 6:134419453-134419475 AAGTTTTTCCAGGTGAAGTATGG - Intergenic
1017969856 6:159302896-159302918 AGGTTTTTCCACCTTCTGTGCGG - Intergenic
1018330850 6:162726774-162726796 AGGTTTCTCCAGGTTATGTATGG - Intronic
1018499670 6:164393134-164393156 AGACTTAGCCAGTTGCTGTAAGG - Intergenic
1019226056 6:170510462-170510484 AGCATTTTCCAGTTTCTTTAAGG + Intergenic
1022523477 7:31022678-31022700 TGGTCTTTCCAGATGCTGGAGGG + Intergenic
1027732491 7:81892682-81892704 TGCTTTTTCCATTGGCTGTAAGG + Intergenic
1028201840 7:87971594-87971616 ACGTTTTTCCAGTATCTGTGAGG + Intronic
1029593603 7:101524329-101524351 AGGTTTTTCCCTTAGCAGTAGGG - Intronic
1030892306 7:115013967-115013989 TTGTTTTTCCAGTCGCTGCATGG + Intronic
1036048790 8:5172930-5172952 AGGTTTTTCGGCTTGCTGTGGGG - Intergenic
1037173040 8:15916470-15916492 AGCTTCTTCAAGATGCTGTAAGG - Intergenic
1037515374 8:19625754-19625776 AGGATTTTCCACTTGCCTTAAGG - Intronic
1037842746 8:22256812-22256834 AGGTTTTACCAGTTGAGGTTTGG - Intergenic
1039080756 8:33731955-33731977 GGGTTTTTTAAGTTGCTTTATGG - Intergenic
1039122439 8:34162437-34162459 ATGTTCTTCAAGTTTCTGTAAGG - Intergenic
1040421413 8:47243382-47243404 AGGTTTCTACAGTTGCTTCAAGG - Intergenic
1042355281 8:67821128-67821150 ATGTGTTTCCATTTGCTGTGAGG + Intergenic
1042535444 8:69854018-69854040 ATATATGTCCAGTTGCTGTAAGG - Intergenic
1047072307 8:121358600-121358622 AGGTTTTCCCAGATGCTGATGGG + Intergenic
1048964106 8:139602845-139602867 AGGATTTTCCACTTGCAGAAAGG + Intronic
1049842382 8:144781239-144781261 AGGATTTACCAGTTCCTGTTTGG - Intronic
1052367972 9:27634845-27634867 AAGTATTTTCAGTTGTTGTAAGG + Intergenic
1052661195 9:31434446-31434468 AGTATTTTCCAGAGGCTGTATGG + Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054880774 9:70142479-70142501 AGGTTTTTCTGGCTGTTGTATGG + Intronic
1055417514 9:76099473-76099495 GTGTTTTTCCAGCTGCTGTTAGG + Intronic
1055989251 9:82087792-82087814 ATTTTTTTCCAGTTGCTAAAAGG - Intergenic
1056277050 9:85003679-85003701 AGAATCCTCCAGTTGCTGTATGG + Intronic
1056703485 9:88931600-88931622 ATGTTTCTCCATTTGCTGTATGG + Intergenic
1056821436 9:89844911-89844933 AGCTTTTTCCAGTTATTGTTTGG - Intergenic
1056828849 9:89897438-89897460 GGGTTTTTCCTGTTGATGTTTGG + Intergenic
1203572196 Un_KI270744v1:141911-141933 ACGGTTTCCCAGTTGCTGTTTGG + Intergenic
1193530673 X:82650543-82650565 AGGGTTTTCCAATTCATGTAAGG + Intergenic
1195462273 X:105140900-105140922 AAGCTTTTCTAGTTGCTGTTTGG - Intronic