ID: 1144028351

View in Genome Browser
Species Human (GRCh38)
Location 17:11298294-11298316
Sequence AGTGGGACACACAATAAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144028344_1144028351 26 Left 1144028344 17:11298245-11298267 CCTACTGCCTCTAGCCTGGAACC 0: 1
1: 0
2: 0
3: 14
4: 187
Right 1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 189
1144028345_1144028351 19 Left 1144028345 17:11298252-11298274 CCTCTAGCCTGGAACCAGAAATA 0: 1
1: 0
2: 0
3: 11
4: 167
Right 1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 189
1144028347_1144028351 5 Left 1144028347 17:11298266-11298288 CCAGAAATATGAGATCAACCACT 0: 1
1: 0
2: 0
3: 11
4: 151
Right 1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 189
1144028346_1144028351 12 Left 1144028346 17:11298259-11298281 CCTGGAACCAGAAATATGAGATC 0: 1
1: 0
2: 0
3: 11
4: 193
Right 1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG 0: 1
1: 0
2: 0
3: 13
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144028351 Original CRISPR AGTGGGACACACAATAAGAG AGG Intronic
904646503 1:31971524-31971546 AGTGGGACTGACAATAAGCCAGG + Intergenic
907690343 1:56658408-56658430 AGTTGGAAAGACATTAAGAGAGG + Intronic
910403595 1:86861620-86861642 AGTGGAAAAAACAACAAGAGAGG - Intergenic
911837303 1:102636692-102636714 AGTGGGACCCAGAGTAAAAGAGG - Intergenic
911877487 1:103186789-103186811 AGTCTCCCACACAATAAGAGTGG + Intergenic
912022184 1:105119184-105119206 ACTGGGACAAAAAGTAAGAGGGG + Intergenic
913692434 1:121291908-121291930 GGTGAGAAACTCAATAAGAGAGG + Intronic
914145123 1:144988194-144988216 GGTGAGAAACTCAATAAGAGAGG - Intronic
915553746 1:156649778-156649800 AGGGTGACCGACAATAAGAGAGG + Intronic
917436385 1:175025279-175025301 AGTGGCCCACACACTAAGGGGGG - Intergenic
918916245 1:190642329-190642351 ACTGGGACACTCAAGAACAGTGG + Intergenic
920479755 1:206310265-206310287 GGTGAGAAACTCAATAAGAGAGG + Intronic
1073943305 10:108722502-108722524 AGAGAGTCACACAATAATAGTGG + Intergenic
1075662964 10:124210858-124210880 AGTGGGTCCCAGAGTAAGAGAGG + Intergenic
1077238242 11:1494777-1494799 AGAGTGACACCGAATAAGAGTGG - Intronic
1079600844 11:22312150-22312172 ATTGGTTCACACAATTAGAGAGG + Intergenic
1081178885 11:39963615-39963637 AAAAGGACACACAATAAAAGAGG + Intergenic
1081316820 11:41640009-41640031 AGATAGACACACAATAATAGTGG - Intergenic
1082201024 11:49367604-49367626 AGTAGGACAGGCAATTAGAGAGG + Intergenic
1085997263 11:81934210-81934232 AGAAGGACACAGTATAAGAGAGG + Intergenic
1086654653 11:89338601-89338623 AGTAGGACAGGCAATTAGAGAGG - Intronic
1086956311 11:92937800-92937822 AGTTGGACACAGAATGACAGAGG + Intergenic
1087903933 11:103673876-103673898 TGTGGGACAGAAAATGAGAGTGG - Intergenic
1087918166 11:103833948-103833970 AGATGGCCACACAATAACAGTGG + Intergenic
1088237284 11:107739401-107739423 AGAGAGCCACACAATAATAGTGG - Intergenic
1089568158 11:119383486-119383508 AGTGGGAGACGCGATCAGAGAGG + Intergenic
1089772518 11:120813961-120813983 AGAGGGAAACACAGTGAGAGAGG - Intronic
1090567350 11:128009004-128009026 AGTGTCCCACACAATAATAGTGG + Intergenic
1091050663 11:132367254-132367276 AGTGGGAGACACCAGAAGAAAGG - Intergenic
1091388668 12:111741-111763 AGTGGGCCACACAAATCGAGTGG + Intronic
1091657481 12:2356021-2356043 AGTTGGACACTCAATAAATGGGG + Intronic
1093093421 12:14946160-14946182 AGTGGGAGACACAATAGGGATGG - Intronic
1098502042 12:71204249-71204271 AGAGAGCCACACAATAATAGTGG + Intronic
1099807581 12:87539822-87539844 AGTGGAACAGAAGATAAGAGGGG - Intergenic
1101549675 12:105750340-105750362 ATTGGGACACACAGGGAGAGAGG + Intergenic
1103744158 12:123110904-123110926 AGTGGGAGACACAGTCCGAGAGG + Intronic
1105332150 13:19427832-19427854 AATGGCACCCACAATAAGAAAGG + Intronic
1105997011 13:25682244-25682266 AGGGAAACCCACAATAAGAGTGG - Intronic
1107485975 13:40827907-40827929 AATGGCACCCACAATAAGAAAGG + Intergenic
1108693292 13:52879472-52879494 AGTGGGGCACAAAAAAGGAGGGG + Intergenic
1109566481 13:64122026-64122048 AGTGTGACTCAAAATAAGAATGG + Intergenic
1109954866 13:69552460-69552482 AGTGAGACACAGAGCAAGAGAGG - Intergenic
1110666626 13:78124954-78124976 ACAGGGACACACATGAAGAGTGG + Intergenic
1112173424 13:96996434-96996456 AGGAGGACACAGAATTAGAGTGG + Intergenic
1112480289 13:99769015-99769037 GGAGGGACATACAATAACAGTGG + Intronic
1113094098 13:106645455-106645477 TGAAGGACTCACAATAAGAGAGG + Intergenic
1116053880 14:39839387-39839409 ACTGGGTCACAGAATAAAAGGGG + Intergenic
1119082219 14:71705905-71705927 AGTGGGGAAAAAAATAAGAGGGG - Intronic
1122873586 14:104652411-104652433 CCTGGAACACAAAATAAGAGTGG - Intergenic
1124052548 15:26211177-26211199 CGTGGGACACACAAGAAGAAGGG - Intergenic
1124668018 15:31610335-31610357 AGATGGCAACACAATAAGAGTGG + Intronic
1125792345 15:42377196-42377218 AGTAGGACACTGAATAGGAGTGG + Intronic
1126433332 15:48609969-48609991 AATAGGACACACAATAAGGGGGG + Intronic
1126551738 15:49938637-49938659 AGAGAGCCACACAATAATAGAGG + Intronic
1128087424 15:64895716-64895738 AGAGGGACAAAGAAGAAGAGAGG - Intronic
1133005585 16:2879810-2879832 AGTGGGCCACACGGGAAGAGAGG - Intergenic
1138389696 16:56661466-56661488 AGAAGGACAGACAATGAGAGGGG - Intronic
1138735623 16:59247376-59247398 AGTGTGTCACACAGTGAGAGAGG - Intergenic
1141609745 16:85174643-85174665 AGGGGGACACACATGAGGAGTGG + Intronic
1144028351 17:11298294-11298316 AGTGGGACACACAATAAGAGAGG + Intronic
1144616293 17:16777242-16777264 AGTTGGCAACACAATAATAGTGG + Intronic
1144896410 17:18538417-18538439 AGTTGGCAACACAATAATAGTGG - Intergenic
1145135807 17:20405800-20405822 AGTTGGCAACACAATAATAGTGG + Intergenic
1147984095 17:44294588-44294610 AGTGGGGCCCACAACAAGAGAGG - Intergenic
1149136981 17:53379214-53379236 AGACAGACACACAATAATAGTGG - Intergenic
1153711787 18:7807495-7807517 TGTGGGACACACAACATGGGCGG - Intronic
1158185764 18:54769425-54769447 AGATGGACAAACAATAAAAGAGG - Intronic
1158522358 18:58182347-58182369 AGTGGGACAGAAAATGAGGGAGG + Intronic
1166554055 19:43686465-43686487 ACTGGGACACCCAGCAAGAGAGG - Intergenic
930627669 2:53716663-53716685 AGAGGGACACACAAAATGTGTGG - Exonic
933165225 2:79068163-79068185 AGTGGAACAGAGCATAAGAGAGG + Intergenic
934591830 2:95560361-95560383 AGACAGACACACAATAATAGTGG - Intergenic
935748653 2:106211457-106211479 ACTGGGACACAGAATCAGAATGG + Intergenic
937773977 2:125753882-125753904 AGTGGGACACTGATTGAGAGAGG - Intergenic
938781419 2:134588276-134588298 AGTGAGTCAGACAATAAGAAAGG + Intronic
938961117 2:136342517-136342539 ACAGGGTCAGACAATAAGAGAGG + Intergenic
938996632 2:136685633-136685655 AGAGGGCAACACAATAATAGAGG + Intergenic
939038768 2:137163465-137163487 ATTGAGACACAGAAGAAGAGAGG + Intronic
939268757 2:139911070-139911092 ATTTGTACACACAATAAAAGAGG - Intergenic
941302500 2:163821100-163821122 AGTGCTACACCCAGTAAGAGTGG - Intergenic
942124457 2:172809490-172809512 ACTGGGACACAGGATCAGAGTGG + Intronic
943467603 2:188247947-188247969 AGTGGGACACAAAATAGATGTGG + Intergenic
945469168 2:210207366-210207388 AGTGGGACAAGCAATAAGCCAGG - Intronic
1170187057 20:13602799-13602821 ACTGGGCCACACAGTAGGAGGGG - Intronic
1173010166 20:39175185-39175207 ACAGGGACACACAGTAATAGGGG + Intergenic
1173937020 20:46875452-46875474 CTTGTGACACACAATCAGAGGGG + Intergenic
1176740864 21:10600751-10600773 AATGGCACCCACAATAAGAAAGG - Intronic
1181589472 22:23875085-23875107 AGTGAAACACACAGAAAGAGAGG - Intronic
1181866200 22:25857424-25857446 GGTGGGAGACAGAATAACAGTGG - Intronic
1183796426 22:40122322-40122344 AGTGGCACACATAATAGCAGTGG - Intronic
949445984 3:4133997-4134019 AGGGGCACACACAATAATAATGG + Intronic
949986461 3:9545090-9545112 TGTGAGAAACACAAGAAGAGGGG + Intronic
950707870 3:14794089-14794111 AGTGGGAGAAACAATAACAATGG + Intergenic
951009897 3:17664577-17664599 AGAGGGACAGACAAAAAGAGAGG + Intronic
952219049 3:31306022-31306044 AGTGTGACATGCAATAAGTGTGG + Intergenic
952732701 3:36655503-36655525 AGTTGGCAACACAATAATAGTGG + Intergenic
952901641 3:38115239-38115261 GGAGGAACAGACAATAAGAGGGG + Intronic
953710913 3:45270068-45270090 AGTGGGAGAGAGAGTAAGAGTGG - Intergenic
956260794 3:67338459-67338481 AGATGGCCACACAATAACAGTGG + Intergenic
956816684 3:72914430-72914452 AGTGGGACACACAAATAAGGAGG + Intronic
957585390 3:82125995-82126017 AGTTGGACACAGAATAAGAAGGG + Intergenic
958255790 3:91323484-91323506 AGTGGGAGACACAGTAGGAAGGG + Intergenic
960457163 3:117886423-117886445 AGTCCGACACACATTAAGATTGG + Intergenic
960743210 3:120857345-120857367 AGAGGGCCACCAAATAAGAGAGG - Intergenic
961473409 3:127132505-127132527 AGTGCAACACACAATAACACAGG - Intergenic
963428298 3:145161395-145161417 AGTGAGACACACAAAAATGGAGG - Intergenic
963989439 3:151636069-151636091 AGTGGGGTACATTATAAGAGAGG - Intergenic
964376243 3:156051853-156051875 AGTGGGCCCCACAGTCAGAGCGG + Intronic
965060856 3:163784172-163784194 AGACAGAAACACAATAAGAGTGG - Intergenic
965958557 3:174401322-174401344 ACTTGGACACACAATAATAGAGG + Intergenic
966039494 3:175464203-175464225 AGTGGGACATAGAATAAAACTGG - Intronic
968475966 4:808668-808690 CCTGGGACACACAAAACGAGGGG + Intronic
969553093 4:7885231-7885253 AGTGTGACACATAAGCAGAGTGG - Intronic
969680530 4:8640839-8640861 AGTCAGACACAAACTAAGAGGGG - Intergenic
969887586 4:10229443-10229465 AGTGGAGCCCAGAATAAGAGTGG - Intergenic
971472059 4:27037900-27037922 AGATTGACACACAATAATAGTGG - Intergenic
971792373 4:31185255-31185277 AGCGGGCCACACACTCAGAGTGG - Intergenic
972254836 4:37342281-37342303 AGTGAGTCACATAATGAGAGAGG - Intronic
972994891 4:44868442-44868464 AGTTGGCTACAGAATAAGAGTGG - Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
976315087 4:83651490-83651512 AGTGGGTCACTCTATAAGATGGG + Intergenic
976700478 4:87965117-87965139 AGTGGGAAAAACAAAAACAGAGG + Intergenic
977351330 4:95891891-95891913 AGTGGAAAATACAAAAAGAGAGG - Intergenic
978506465 4:109463135-109463157 AGTGGATCCCACAATATGAGGGG - Exonic
978713499 4:111813949-111813971 AGTGGGCCACAAAATGAGAATGG + Intergenic
978982651 4:114968356-114968378 AGTGGGACATACAATCACAAAGG - Intronic
980023649 4:127738715-127738737 AGCCAGTCACACAATAAGAGTGG - Intronic
980628838 4:135408324-135408346 AGTGGCACACACAGAAAAAGCGG + Intergenic
981239427 4:142458530-142458552 AGTGGGAAACAGCCTAAGAGAGG + Intronic
982293355 4:153802159-153802181 AGTGGGACCCAAAACAAAAGAGG + Intergenic
984288428 4:177762929-177762951 AGTGGGTCCCAGAACAAGAGAGG - Intronic
984828407 4:183949186-183949208 AGAGGAAGAAACAATAAGAGAGG + Intronic
987210974 5:15683034-15683056 GGTGGTACATAGAATAAGAGAGG + Intronic
988407960 5:30849012-30849034 AGAGGGGCACACAATTTGAGGGG - Intergenic
992543050 5:77783355-77783377 AATGGGACACAGATCAAGAGTGG + Intronic
994145509 5:96390301-96390323 TTTGGGAAACACAATAAAAGAGG + Intergenic
999031008 5:148290937-148290959 AGGGGGACACAAAAGAAAAGAGG - Intergenic
999105254 5:149064837-149064859 ACTAGGACACACAATGAGAAAGG + Intergenic
999175323 5:149627836-149627858 TGTGTGACCCACAATATGAGGGG + Intronic
999585182 5:153082051-153082073 AGAGGGAAACAGAAAAAGAGGGG + Intergenic
1001707011 5:173748787-173748809 AGTGGTAAACACAATGTGAGTGG - Intergenic
1003899797 6:10643964-10643986 AGTGAGACACCCAAGAGGAGAGG - Intergenic
1007250469 6:40491621-40491643 AGAGGGAAACACACTCAGAGAGG - Intronic
1007250531 6:40492079-40492101 AGAGGGAAACACACTCAGAGAGG - Intronic
1007339487 6:41181524-41181546 TTGGGGACACACAATAAAAGAGG + Intergenic
1008999555 6:57697681-57697703 AGTGGGAGACACAATAGGAAGGG - Intergenic
1009188038 6:60597105-60597127 AGTGGGAGACACAATAGGAAGGG - Intergenic
1009563173 6:65275028-65275050 AGTGGGACCCATAATAAGGGAGG + Intronic
1014977428 6:127904876-127904898 AATGGGACATACAGTAAGAGAGG + Intronic
1016641489 6:146354308-146354330 AGTGGGACACAGGATGAAAGAGG - Intronic
1018834634 6:167473691-167473713 AACGGGACACACAACAAGAGTGG - Intergenic
1021068559 7:16208622-16208644 GGTGGGACACACAATAGTATAGG - Intronic
1028766248 7:94563201-94563223 AGTGGACCACACAAGAAAAGTGG + Intergenic
1029936922 7:104435040-104435062 ATTGTGACACCCAATAAGGGGGG - Intronic
1032985034 7:137328413-137328435 AGTGGGACACAGATGAACAGAGG - Intronic
1033835943 7:145312405-145312427 ACTTGGACACACATAAAGAGTGG + Intergenic
1033884050 7:145922577-145922599 AGTGAGATACACAGAAAGAGAGG + Intergenic
1034023318 7:147669708-147669730 AATGGGAAACAAAAGAAGAGTGG - Intronic
1034129397 7:148700891-148700913 TGTGGTACACACATTAGGAGTGG - Intronic
1036604037 8:10290680-10290702 AGTGGGCTACACAAGGAGAGTGG - Intronic
1037269640 8:17112446-17112468 AGAGGGACAGACAGTCAGAGAGG - Intronic
1037588918 8:20296649-20296671 AGAGGGAGAGACAATGAGAGTGG + Intronic
1037949555 8:23010007-23010029 AGTGGGATACAGAATAAGTAAGG - Intronic
1039741199 8:40384480-40384502 AGAGGGACACACAGAGAGAGGGG + Intergenic
1041360234 8:57045322-57045344 ATTGGCTCACACAATCAGAGAGG + Intergenic
1041584754 8:59502616-59502638 AGTCAGACATACAATAATAGTGG + Intergenic
1043012177 8:74894583-74894605 AGTGGGTCACACATCCAGAGGGG - Intergenic
1043652402 8:82612860-82612882 AGTAAGCCACACAATAATAGTGG - Intergenic
1046186180 8:110722862-110722884 AGTGGGACAGAGAATGGGAGCGG - Intergenic
1047630464 8:126700760-126700782 AGACGGCCACACAATAATAGTGG + Intergenic
1048314494 8:133352079-133352101 ACTGGGACACACACAAACAGAGG - Intergenic
1049995426 9:1029638-1029660 AGTGTGAAACACAAAATGAGGGG + Intergenic
1050480414 9:6081920-6081942 GGTGGGACTCAAAATAAAAGAGG - Intergenic
1050586455 9:7116867-7116889 AGCGGGAGACAAAATTAGAGAGG - Intergenic
1050601637 9:7258719-7258741 AAAGGGACTCACAATAAAAGTGG + Intergenic
1051090252 9:13398789-13398811 CCTGGGACACACAATAAGTACGG + Intergenic
1051137141 9:13935091-13935113 AGTGGGAAACACAATATTTGAGG + Intergenic
1051149426 9:14064265-14064287 AACAGGACACACAAAAAGAGAGG - Intergenic
1052546157 9:29882696-29882718 AGTGGGACAAAACATTAGAGGGG - Intergenic
1054707084 9:68473685-68473707 TGTTGGTCATACAATAAGAGAGG - Intronic
1055275582 9:74611985-74612007 ACTGGGAGACACACAAAGAGAGG + Intronic
1055889101 9:81103874-81103896 ACTGGGACACACAATCAATGTGG - Intergenic
1060003368 9:119978482-119978504 AGTGGGGCTCACAAAAAGGGTGG - Intergenic
1189409738 X:40759802-40759824 GGTGGGAGACACAAAAAGAGAGG - Intergenic
1190635365 X:52427403-52427425 AGTGAGACTCACCATAAGGGTGG - Intergenic
1192102033 X:68274994-68275016 AATGGGAGAAAGAATAAGAGGGG + Intronic
1192682088 X:73262877-73262899 GGTGGGACTCAAAATAAAAGAGG + Intergenic
1193190127 X:78561363-78561385 AGTGCCCCACACAATAATAGTGG - Intergenic
1193965338 X:87977916-87977938 AGAGGGCAACACAATAATAGTGG + Intergenic
1194058602 X:89167866-89167888 AGATGGTCACACAATAATAGTGG + Intergenic
1194076206 X:89397709-89397731 AGAAGGCAACACAATAAGAGTGG - Intergenic
1194631915 X:96295569-96295591 AGATGGAAACACAATAATAGTGG + Intergenic
1194845480 X:98802056-98802078 AGTGTGACATACAATGAGAGGGG + Intergenic
1195139346 X:101943290-101943312 AGAGGGACACAGCATAATAGTGG - Intergenic
1195963363 X:110408066-110408088 AGTGGGGCACCCAAAGAGAGTGG + Intronic
1197562771 X:128045237-128045259 AGACAGACACACAATAATAGTGG - Intergenic
1198398091 X:136243215-136243237 AGAGTGACAGAAAATAAGAGAGG + Intronic
1199777628 X:151029309-151029331 AGAGGGACAAACAAGCAGAGAGG + Intergenic
1200110372 X:153737861-153737883 AGTGGGGGTCACAAGAAGAGTGG + Intronic
1200428844 Y:3053231-3053253 AGAAGGCAACACAATAAGAGTGG - Intergenic
1200648829 Y:5816501-5816523 AGTGGGCCTCACACTCAGAGTGG - Intergenic
1201972720 Y:19814823-19814845 GGTGGGACTCAAAATAAAAGCGG + Intergenic
1202599126 Y:26574608-26574630 AATGGCACCCACAATAAGAAAGG - Intergenic