ID: 1144028695

View in Genome Browser
Species Human (GRCh38)
Location 17:11301094-11301116
Sequence CTCTGACAGCTAGACGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144028695_1144028702 26 Left 1144028695 17:11301094-11301116 CCTTCCACGTCTAGCTGTCAGAG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1144028702 17:11301143-11301165 GCAGACCCCTTTAATGCAGCTGG 0: 1
1: 0
2: 1
3: 6
4: 79
1144028695_1144028698 1 Left 1144028695 17:11301094-11301116 CCTTCCACGTCTAGCTGTCAGAG 0: 1
1: 0
2: 1
3: 7
4: 95
Right 1144028698 17:11301118-11301140 CTCTCTGCCTGTGCTGAGCCCGG 0: 1
1: 1
2: 4
3: 51
4: 399

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144028695 Original CRISPR CTCTGACAGCTAGACGTGGA AGG (reversed) Intronic
901193340 1:7425590-7425612 CTCTGACAGCAAGAAGTGCCTGG - Intronic
904467959 1:30719118-30719140 CTCTGACTGAGAGACGTGGCTGG + Intronic
904813482 1:33179285-33179307 CTCAGACAGCTAGACTGGAAGGG + Intronic
907412357 1:54291821-54291843 GCCTGACAGCTGGGCGTGGAGGG - Intronic
915242429 1:154532900-154532922 CACTGACATCTTGGCGTGGATGG + Intronic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1062891473 10:1063851-1063873 CTCTGCCAGGTGGATGTGGACGG - Intronic
1062893423 10:1084135-1084157 GTCTGACAGCCAGGCATGGAAGG - Intronic
1063073743 10:2693039-2693061 CTCTTAGAGCTAGATGAGGAGGG - Intergenic
1063095729 10:2907362-2907384 CTCTCAGAGCAAAACGTGGAAGG - Intergenic
1063175735 10:3549347-3549369 TTCTGCCTGCTAGACCTGGAGGG + Intergenic
1072143561 10:92612763-92612785 CTCTGAAAGCTGGATGTGGGTGG - Intronic
1072943252 10:99786213-99786235 CTCTGGAAGCTAGAAGTGGTAGG + Intronic
1074454980 10:113588780-113588802 CTCTGATACCTAGACGTGGATGG - Exonic
1074692320 10:116017344-116017366 TCCTGACAGTTGGACGTGGATGG + Intergenic
1077084812 11:744218-744240 CTCTGTGACCTAGAAGTGGAAGG - Intergenic
1077310820 11:1888376-1888398 CTTTGACAGCTGGATGAGGAGGG - Intronic
1079254019 11:18810916-18810938 CTCTCACAGCTGAACGTGGCTGG + Intergenic
1081368524 11:42267855-42267877 CTCAGACACCTAGTTGTGGAAGG + Intergenic
1087362114 11:97174156-97174178 CTCTTACAAGTAGACATGGAGGG - Intergenic
1089623910 11:119739435-119739457 CTCAGACAGCTGGTCCTGGAAGG + Intergenic
1094496163 12:30990660-30990682 CTCTGACAGCTAGCTGGGGGAGG - Intronic
1095646891 12:44558404-44558426 CTCAGAGAGATAAACGTGGAAGG + Intronic
1095860554 12:46912434-46912456 CTCTGAAAAATAGAAGTGGAGGG + Intergenic
1096181900 12:49555808-49555830 CTCTGCCACCTAGACGAGGCCGG - Exonic
1098607308 12:72407160-72407182 CTCTGAAAGCTAGATGGGGAAGG + Intronic
1098862172 12:75722354-75722376 ATCTGACAGGTAGACAGGGAAGG - Intergenic
1101122302 12:101595011-101595033 TTCTGTCAACTAGTCGTGGAGGG + Exonic
1105569346 13:21586514-21586536 CTTTGACAGGCTGACGTGGAAGG - Intronic
1108334085 13:49421363-49421385 CTCTTACAGCCAGACAGGGATGG - Intronic
1108863657 13:54895264-54895286 CTCTGACATCTAGAGGTCAAGGG - Intergenic
1110327354 13:74232112-74232134 CTCTGCCAGCAAGACTTGGAAGG - Intergenic
1124454829 15:29832391-29832413 CTCAGACAGCTAGACTTGCCTGG - Intronic
1124996940 15:34732651-34732673 CTCTGCCAGCTAGACGTGCCTGG - Intergenic
1126946843 15:53830989-53831011 CTCAGACACCGAGTCGTGGAAGG + Intergenic
1139332303 16:66202836-66202858 CTCTGACTCCCAGACTTGGAGGG - Intergenic
1141910708 16:87056776-87056798 CTCAGACTGCTGGCCGTGGAGGG - Intergenic
1141976927 16:87522937-87522959 CTCTTGCAGCTAGACGTGGCTGG - Intergenic
1144028695 17:11301094-11301116 CTCTGACAGCTAGACGTGGAAGG - Intronic
1144872695 17:18380731-18380753 CTCTGTGAGCTAGACCTGGTTGG - Intronic
1145886512 17:28385573-28385595 CTCTGAAATCTAGACCTGGGTGG - Intronic
1147313876 17:39609902-39609924 CTCTGGCAGATAGTCGTGGTGGG + Intergenic
1153215671 18:2818403-2818425 CTCAGAAAACTAGACATGGAAGG + Intergenic
1156980542 18:43282655-43282677 TTCTGATAGCTGGAAGTGGAAGG + Intergenic
925400313 2:3568164-3568186 CTCTGCCAGCTGTAAGTGGAGGG + Intergenic
928251984 2:29689120-29689142 CTCTGACACCTACATGTGTATGG - Intronic
928881556 2:36102405-36102427 CTCTGATAGCCAGTCGTGGTGGG - Intergenic
931305994 2:61028937-61028959 CTTTGAGAGGTAGAAGTGGAAGG + Intronic
934724610 2:96607756-96607778 GTCTGGCAGACAGACGTGGAGGG - Intronic
935898061 2:107759247-107759269 CTGTAACAGCTACACTTGGAAGG - Intergenic
942974278 2:181996270-181996292 CTGTGAAAGCCAGAGGTGGAGGG + Intronic
946539891 2:220672518-220672540 CTCTGACAGCCAGAATGGGAAGG + Intergenic
947154166 2:227144819-227144841 CTCTGAAAGTGAGACCTGGAGGG + Intronic
1170592030 20:17778392-17778414 CACTGACTGCAAGACCTGGAAGG + Intergenic
1179456453 21:41504318-41504340 CTCTGACATCTATGTGTGGATGG - Intronic
1183989713 22:41589741-41589763 CTCTGCCTGTTTGACGTGGACGG - Exonic
1184513132 22:44944655-44944677 CTCTATCTGCTAGATGTGGATGG + Intronic
1185043344 22:48516882-48516904 CTCTGAGAGCAGGACCTGGATGG - Intronic
1185191994 22:49444239-49444261 CTTAGACAGCTAGGCGTTGAAGG + Intronic
951998464 3:28757279-28757301 ATCTGACAGCTAAAGGTTGATGG - Intergenic
959782963 3:110258332-110258354 CCATTACAGCTGGACGTGGAAGG - Intergenic
960466137 3:117998165-117998187 CTATTACAGCTACACGAGGATGG + Intergenic
961038114 3:123657276-123657298 CTCAGCCAACAAGACGTGGAAGG - Exonic
961485424 3:127212516-127212538 TTCTGACAACCAGAGGTGGATGG - Intergenic
962035720 3:131649584-131649606 CTCTCACAGTTAGAAGTGAAAGG - Intronic
981320983 4:143391006-143391028 CTCTGGCAGCCAGATGTGGGCGG - Intronic
986359453 5:6962364-6962386 TGCTGGCAGCTAGACTTGGATGG + Intergenic
986443850 5:7804139-7804161 CTCTGAGTGCTTGAGGTGGATGG - Intronic
989763842 5:45054323-45054345 CTTTGGCAGCTAAACGTGAAAGG - Intergenic
991404860 5:66291954-66291976 CCCTGACAGCTAGCCTTGGGTGG - Intergenic
992618548 5:78569876-78569898 CTCTAACAGCTTTACGTTGATGG - Intronic
996959120 5:129223058-129223080 CTATCACAGCTAGAAATGGAAGG - Intergenic
1000550917 5:162663184-162663206 TTCAGACAGGTAGCCGTGGAAGG - Intergenic
1001045293 5:168366643-168366665 CTCTGACATCTCAACGTGTAAGG + Intronic
1001694874 5:173662514-173662536 CTCTCACTGATGGACGTGGATGG - Intergenic
1004619426 6:17320184-17320206 CTCTGAGCGCCAGGCGTGGAGGG + Intergenic
1006515352 6:34542386-34542408 GTCTGTCAGCCAGACCTGGAAGG - Intronic
1006922137 6:37634034-37634056 CTCTGAGAGGTAGGGGTGGAAGG + Exonic
1008044894 6:46841778-46841800 CTCTGATAATTAGAAGTGGATGG + Intergenic
1008854029 6:56060027-56060049 CTCTGACACCTGGACGTCCAGGG + Exonic
1011562578 6:88636436-88636458 CTCAGGCAGCTAGTCATGGAAGG + Intronic
1013707565 6:112856426-112856448 ATCTGACAGCTGGATGTTGATGG + Intergenic
1016581599 6:145634373-145634395 CTTTGATAGGTAGATGTGGAGGG - Intronic
1017025920 6:150180445-150180467 CTGTGAGAGCTATACGTGGCAGG + Intronic
1021712740 7:23432180-23432202 GTCTGACAGCCAGACGTGCATGG + Intronic
1023725291 7:43137029-43137051 CTCTAACAGGTTGACCTGGATGG - Intronic
1030469257 7:109941970-109941992 CTCAGACACCTAGCTGTGGAAGG - Intergenic
1032156019 7:129468885-129468907 GTCTTACAGATAGACGTGAAAGG - Intronic
1036441453 8:8785000-8785022 ATCTGACAGCCAGATGTGGAAGG + Exonic
1037041463 8:14240570-14240592 CTCTGAGAGCTACACGTTTATGG - Intronic
1037925000 8:22837543-22837565 AACTGACAGCTAGAGGTGCAGGG - Intronic
1043847564 8:85179282-85179304 CTCTGACGGCTGGACTTTGAGGG + Intronic
1044652530 8:94512531-94512553 CTCTGAGAGGTTGAGGTGGAAGG + Intronic
1053652666 9:40184978-40185000 CTCTGATAATTAGAAGTGGATGG - Intergenic
1053903069 9:42814285-42814307 CTCTGATAATTAGAAGTGGATGG - Intergenic
1054531915 9:66191243-66191265 CTCTGATAATTAGAAGTGGATGG + Intergenic
1055552687 9:77445867-77445889 CTCTGTCAACTAGAGGAGGAAGG - Intronic
1057537661 9:95929960-95929982 TTCTGACAGATAGAGGTGAAGGG - Intronic
1061265257 9:129501015-129501037 CTCTGACCGGCAGACATGGATGG + Intergenic
1061651612 9:132054886-132054908 TTCTGACAGGCAGACGTGGAGGG - Intronic
1062694614 9:137866996-137867018 CTCTGACAGCTGGTAGAGGAAGG - Intronic
1186808945 X:13167990-13168012 CTCTGAGAGCAGGAAGTGGAAGG - Intergenic
1187493331 X:19773204-19773226 CTCGGAGAGCCAGAGGTGGAAGG - Intronic
1192194481 X:69019158-69019180 CTCAGACAGCTATAGGTAGATGG + Intergenic