ID: 1144029116

View in Genome Browser
Species Human (GRCh38)
Location 17:11304081-11304103
Sequence TACCCAAAGCTTCCCAGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 172}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144029116_1144029120 6 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029120 17:11304110-11304132 ACCTTTCCTGGTGAGCGATAGGG 0: 1
1: 0
2: 0
3: 4
4: 81
1144029116_1144029125 25 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029125 17:11304129-11304151 AGGGTCCCCAGTGGGTAACGAGG 0: 1
1: 0
2: 0
3: 13
4: 85
1144029116_1144029126 26 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029126 17:11304130-11304152 GGGTCCCCAGTGGGTAACGAGGG 0: 1
1: 0
2: 0
3: 10
4: 84
1144029116_1144029118 -6 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029118 17:11304098-11304120 TGGGTAGTTTGCACCTTTCCTGG 0: 1
1: 0
2: 2
3: 11
4: 198
1144029116_1144029119 5 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029119 17:11304109-11304131 CACCTTTCCTGGTGAGCGATAGG 0: 1
1: 0
2: 0
3: 8
4: 103
1144029116_1144029124 17 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029124 17:11304121-11304143 TGAGCGATAGGGTCCCCAGTGGG 0: 1
1: 0
2: 0
3: 2
4: 37
1144029116_1144029123 16 Left 1144029116 17:11304081-11304103 CCTTTCCTGGGAAGCTTTGGGTA 0: 1
1: 0
2: 1
3: 9
4: 172
Right 1144029123 17:11304120-11304142 GTGAGCGATAGGGTCCCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144029116 Original CRISPR TACCCAAAGCTTCCCAGGAA AGG (reversed) Intronic
900120744 1:1047707-1047729 CACCCATTGCCTCCCAGGAAGGG - Intronic
902575065 1:17372474-17372496 GACCCAAGGCTTCCCAAGATGGG - Intronic
903959548 1:27047968-27047990 GACCACATGCTTCCCAGGAAAGG - Intergenic
904060009 1:27701614-27701636 CACCCAAAACTACACAGGAAAGG + Intergenic
904607174 1:31704269-31704291 TGCCCAGAGCTGCCCTGGAAGGG + Exonic
905792842 1:40799380-40799402 TAGCCAAATTTTTCCAGGAAGGG - Intronic
905868705 1:41390926-41390948 CGCCCAAAGCCTGCCAGGAATGG - Intergenic
907670753 1:56473049-56473071 TGCCCAAAGTTTCACAGTAAGGG + Intergenic
909919282 1:81360396-81360418 GACCAAAGGCTTTCCAGGAATGG + Intronic
910284144 1:85534881-85534903 TTGCCAAAGCCTCCCAGTAAAGG + Intronic
912948644 1:114105493-114105515 TACCCCCAGCTTCCCAGGAAGGG + Intronic
913594908 1:120366020-120366042 TACCCAAAGCTCCAGTGGAAAGG + Intergenic
914092360 1:144512966-144512988 TACCCAAAGCTCCAGTGGAAAGG - Intergenic
914306172 1:146420905-146420927 TACCCAAAGCTCCAGTGGAAAGG + Intergenic
914595880 1:149151904-149151926 TACCCAAAGCTCCAGTGGAAAGG - Intergenic
915891320 1:159776729-159776751 TTCCCAAAGCTTCCCATGGCAGG + Intergenic
916206756 1:162322392-162322414 TTCCCCAAGCTTCCCAGGGGTGG - Intronic
917134076 1:171771672-171771694 AACCCCAAGGTTCTCAGGAATGG - Intergenic
918102204 1:181386249-181386271 TATCCAAAGTATCCCAGGGAAGG + Intergenic
920639625 1:207739410-207739432 TATCCAAAGCTGGCCAGGCACGG - Intergenic
922825069 1:228512079-228512101 TCCCCAAAGCTTCCAAGAAGAGG - Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1067454431 10:46407518-46407540 CAAACAAAGCTTCCCAGCAAAGG - Intergenic
1067632773 10:47977114-47977136 CAAACAAAGCTTCCCAGCAAAGG + Intergenic
1069285366 10:66708150-66708172 TACACTATGCTCCCCAGGAAAGG - Intronic
1069636892 10:69930438-69930460 TCCCCAAGGCCCCCCAGGAAAGG + Exonic
1073333006 10:102683260-102683282 TCCCCAAAGGTTACCACGAAAGG + Intronic
1074579443 10:114704681-114704703 ACCCCACAGCCTCCCAGGAAGGG - Intergenic
1075206499 10:120453781-120453803 TACCCAAAGCTTCCGAGACTGGG - Intergenic
1076084447 10:127613040-127613062 AAAGCATAGCTTCCCAGGAAAGG + Intergenic
1077856148 11:6128212-6128234 TTCTCAAAGGTTCCCAAGAATGG + Intergenic
1083610415 11:64001618-64001640 TTCCCAGAGCGTCCCAGGGATGG + Intronic
1083751082 11:64760900-64760922 TAGCCAAAGCCTCCAGGGAAGGG - Intergenic
1084590748 11:70088708-70088730 TTGGCAAATCTTCCCAGGAAAGG - Intronic
1087186171 11:95198243-95198265 TTCTCAAAGCTTCCCAACAATGG - Intronic
1089009028 11:115118076-115118098 ACCCCAGAGCCTCCCAGGAAAGG + Intergenic
1090167135 11:124561456-124561478 TCCCCAAACCTTCCCAAGATGGG - Intergenic
1090214183 11:124946351-124946373 TATCCAGATCTTCCAAGGAAGGG - Intergenic
1090623008 11:128578191-128578213 CACCCAAAGCTTGCCAGGGCAGG + Intronic
1093687311 12:22071523-22071545 TACCTAGATCTTCCCATGAAGGG - Intronic
1096104043 12:48986451-48986473 TACCCTCAGCATCCCAAGAATGG - Intergenic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1097470686 12:59987095-59987117 TAACCAAATCTTCCCAAGAAAGG - Intergenic
1105625655 13:22110353-22110375 GACACACAGCCTCCCAGGAAGGG - Intergenic
1106138587 13:26992476-26992498 AACCCACACCTGCCCAGGAAAGG + Intergenic
1106232187 13:27829091-27829113 TAAACAAAGCTTAGCAGGAAGGG + Intergenic
1107820564 13:44281926-44281948 CACTCATTGCTTCCCAGGAATGG - Intergenic
1108270104 13:48751068-48751090 TTCCCAAAGCTTTCAAGGCAAGG - Intergenic
1108709287 13:53017098-53017120 TATGCAAATATTCCCAGGAAGGG - Intergenic
1110237777 13:73234356-73234378 TAGCCAAACATTCCCTGGAAAGG - Intergenic
1110357249 13:74581342-74581364 TCCCCAAAGCTTTCCATGAATGG - Intergenic
1113014567 13:105814028-105814050 TGCCCCAAGCTTCCCATTAAGGG + Intergenic
1113282938 13:108810069-108810091 TACTCAAAGGTTTCCAGAAATGG + Intronic
1116992912 14:51294259-51294281 TACACAAGGCTTGCCAGGCAGGG - Intergenic
1117189815 14:53278594-53278616 TACCAGAGGCTTCCCAGGTAAGG - Intergenic
1119738165 14:76997318-76997340 GACCCAAAGCTGCAAAGGAAAGG + Intergenic
1121678886 14:95776433-95776455 TACTCACACCTTCCCAAGAAAGG + Intergenic
1121728643 14:96171150-96171172 TATCCTAAGCATCCAAGGAAAGG - Intergenic
1123114848 14:105890049-105890071 GAGCCCAGGCTTCCCAGGAACGG + Intergenic
1124136887 15:27042811-27042833 TGCAGAAAGCTTCCCAGGACAGG - Intronic
1124507371 15:30289908-30289930 TACTCAAACCATCCCAGGAAGGG + Intergenic
1124598615 15:31112513-31112535 TAAGCAAAGTTTCCCAGGACTGG - Intronic
1124736184 15:32248751-32248773 TACTCAAACCATCCCAGGAAGGG - Intergenic
1127053437 15:55108444-55108466 TATCCAAAGATACCGAGGAAAGG + Intergenic
1127850162 15:62905021-62905043 TCCCCAAAGCCTCACAGGCAGGG + Intergenic
1129943531 15:79519244-79519266 TAACCGGAGCTCCCCAGGAAAGG + Intergenic
1130746050 15:86655025-86655047 TACTCACAGCTTGCCAGAAAAGG + Intronic
1130821739 15:87503143-87503165 GACCCAAACCTTCACAGGAGGGG + Intergenic
1131669280 15:94601954-94601976 ATCCCACAGCATCCCAGGAACGG - Intergenic
1133222366 16:4324209-4324231 GAGCCAAAGGTTCCCAGGGACGG + Intronic
1133526177 16:6607980-6608002 TACCAAAGCCTTCCCAGTAAAGG - Intronic
1137777859 16:51071492-51071514 CACCCAAAGATTCCCATGGAGGG + Intergenic
1140913281 16:79472880-79472902 TACCCAAATCTCTCCAGGACAGG - Intergenic
1140914328 16:79481172-79481194 TACCCAAATCTCTCCAGGACGGG + Intergenic
1141681558 16:85547175-85547197 TGCCCAGAGCTTCCCAGGGCTGG + Intergenic
1143855261 17:9843544-9843566 TCCCCATGGCTTCCCAGGAAAGG + Intronic
1144022943 17:11252900-11252922 TGCCTGAAGTTTCCCAGGAATGG + Intronic
1144029116 17:11304081-11304103 TACCCAAAGCTTCCCAGGAAAGG - Intronic
1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG + Intronic
1146901742 17:36593208-36593230 TACCGCAAGCTAGCCAGGAAGGG + Intronic
1148213793 17:45823743-45823765 TAACCAAAGCTTGCCAGGCCGGG - Intronic
1148649196 17:49237487-49237509 TGCCCGAATCTTCCCAGGATGGG - Intergenic
1153940358 18:9971282-9971304 TTCCCATGGCTTCCTAGGAAAGG - Intergenic
1157683741 18:49626818-49626840 TACCCATGCATTCCCAGGAAGGG - Intergenic
1158870557 18:61683474-61683496 TGCCCAAAGATACACAGGAAAGG + Intergenic
1159589603 18:70319142-70319164 TACCAAAGTCTTCCCAGAAAGGG - Intronic
1163819424 19:19487554-19487576 CCCCCAGAGCTTCCCAAGAAGGG - Intronic
1164989376 19:32673559-32673581 TCTCCAAAGCTTCCCCCGAAGGG + Intronic
1166431222 19:42729622-42729644 TACCCAGATCTTCCCAGGGCAGG + Intronic
1166480695 19:43170593-43170615 TTCCCACAGGCTCCCAGGAAGGG + Intronic
1167559034 19:50214457-50214479 TGCCCCAAGGGTCCCAGGAAAGG - Intronic
925347028 2:3178708-3178730 CATCCTTAGCTTCCCAGGAATGG - Intergenic
925365567 2:3309629-3309651 AACCCAGAGCATCCCGGGAAAGG + Intronic
925434326 2:3823879-3823901 TTGGCAAAGCTTTCCAGGAAGGG + Intronic
925603602 2:5635366-5635388 TACCCAAAGCTCCAGTGGAAAGG + Intergenic
927838598 2:26422078-26422100 TACAGAAAACTTCCCAGGCAAGG + Intronic
930691090 2:54365424-54365446 GAACAAAAACTTCCCAGGAAAGG + Intronic
935349010 2:102137567-102137589 TGCCCAGAGCTTGCCAGGTAAGG - Intronic
936520652 2:113210195-113210217 TACCCAAATGTCCCAAGGAAGGG - Intergenic
936599584 2:113882776-113882798 TAACCAAATCTTCCCATTAATGG + Intergenic
937958652 2:127438183-127438205 TACCCACAGCCTCCCCGGCATGG - Intronic
940383726 2:153046227-153046249 TACCAGAAGCTTCTCAGGAGAGG + Intergenic
942988202 2:182166478-182166500 TACCAACAGCCTCCCGGGAAGGG + Intronic
943638105 2:190327915-190327937 CAGAGAAAGCTTCCCAGGAAAGG + Intronic
944907925 2:204281468-204281490 TGGCCAATGCTTCCCAGGACTGG - Intergenic
945816963 2:214616970-214616992 TACCCAATTGCTCCCAGGAAGGG + Intergenic
948916858 2:241038873-241038895 TGGGCAGAGCTTCCCAGGAATGG + Intronic
1171278206 20:23876317-23876339 AAGCCAAAGATGCCCAGGAATGG + Intronic
1172252138 20:33487366-33487388 TACTCAGAGAGTCCCAGGAAGGG - Intergenic
1172274655 20:33673199-33673221 CACCCAAAGCAGCCCAGCAAAGG + Intronic
1173460941 20:43243060-43243082 TACCCAATACCTCCCAGGGAAGG + Intergenic
1174299189 20:49569141-49569163 TGCCCAACGCTTCCCAGGGTGGG - Intergenic
1174632697 20:51972073-51972095 TGAGCAAAGATTCCCAGGAAAGG + Intergenic
1175790423 20:61737053-61737075 GAGGCAAACCTTCCCAGGAAGGG - Intronic
1177195950 21:17903650-17903672 AATCGAAAGCTTTCCAGGAATGG + Intronic
1178230300 21:30776064-30776086 TAGCAAAAGCTACCCAGGACTGG - Intergenic
1179592933 21:42422851-42422873 TGCCTAAAGGTTCCCTGGAAGGG + Intronic
1182361564 22:29749473-29749495 CACCCAAGGCTCCCCAGGGAGGG + Intronic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
1183032805 22:35118108-35118130 AAACCAGAGCTGCCCAGGAAAGG + Intergenic
1183264769 22:36818400-36818422 TATCCTAAGGTTTCCAGGAAGGG - Intronic
1185104594 22:48860149-48860171 TACTCAAACCTGCCCAGGCAAGG + Intergenic
1185105729 22:48868729-48868751 GGCCCGCAGCTTCCCAGGAAAGG + Intergenic
950114367 3:10441097-10441119 TCCCTATAGATTCCCAGGAAAGG - Intronic
950378197 3:12589514-12589536 TACCCTAGGCTAGCCAGGAAAGG + Intronic
951303653 3:21029511-21029533 CACCTAAAGCTTCTCAGGGAAGG - Intergenic
952388766 3:32861960-32861982 TATCCACTGCTTCCCAGGATTGG + Intronic
955209151 3:56924962-56924984 TCCCCAAAGCTAGCCAGGTAGGG - Intronic
956527848 3:70184766-70184788 TTCCCAAAGATTCCCCAGAAAGG - Intergenic
957872763 3:86109862-86109884 TACAGAATGCTTGCCAGGAACGG + Intergenic
960884717 3:122382925-122382947 TACCCAGAGCTTCCCAGACAAGG + Intronic
961829480 3:129616112-129616134 TTCCCAGAGCTGTCCAGGAAGGG + Intergenic
962153782 3:132922200-132922222 TTCCCAAAAGTACCCAGGAAGGG + Intergenic
966700434 3:182843177-182843199 TACCCAAACTTTTCCAGGAAAGG + Intronic
971176170 4:24284607-24284629 TACCCAAAGCTTCACAGACTTGG + Intergenic
974972484 4:68846809-68846831 TACTCAATGCTTCCCTGGGAGGG - Intergenic
975601620 4:76106007-76106029 TACACATAGCTTTCCAGGAGAGG - Intronic
980271853 4:130594092-130594114 TACACAAAGCTTCCAAAAAAAGG + Intergenic
980911169 4:138995942-138995964 TACCCACATCTTCCCAGGTGTGG + Intergenic
984840280 4:184061644-184061666 AAGGCAAAGCTTCCCAGCAAGGG - Intergenic
986009959 5:3704688-3704710 TAGACAAAGATTTCCAGGAAAGG - Intergenic
986374386 5:7115202-7115224 TCTCCAAAGCCTCCCAGAAAAGG + Intergenic
989320020 5:40123015-40123037 TCCCCAAAGCTACCCACAAAAGG - Intergenic
991497598 5:67242709-67242731 AACCCAAAGCATCCCAAGAGGGG + Intergenic
998411876 5:141917381-141917403 TTCCCCAAGCCACCCAGGAAAGG - Intergenic
1005389696 6:25320750-25320772 TTTCCAAAGGATCCCAGGAATGG + Intronic
1005610927 6:27524350-27524372 GAAACAAAGCTTACCAGGAAAGG + Intergenic
1005807552 6:29488603-29488625 TACCCAAGGATGCCCAGGACTGG - Intergenic
1006244806 6:32722546-32722568 TACCAAAACATTCCCAAGAAAGG + Intergenic
1006368732 6:33631713-33631735 TCCCCAACTCTTCCAAGGAAAGG + Intronic
1007134294 6:39506822-39506844 TACCCTCATCTTCACAGGAAGGG + Intronic
1007837114 6:44682326-44682348 TTCCCAGACCTTTCCAGGAAGGG + Intergenic
1010348496 6:74841859-74841881 TTCCCACAGCTTCTCAGGCATGG - Intergenic
1013539281 6:111091739-111091761 TACCCAAAATTTCTCAGGAAAGG + Intronic
1014228512 6:118875478-118875500 TACCCAAAACTAGCCAGGCATGG + Intronic
1018279681 6:162172258-162172280 GACCCCAAGCTACCCAGGGATGG + Intronic
1020998569 7:15297671-15297693 TGATCAAAGTTTCCCAGGAAGGG - Intronic
1023069077 7:36410531-36410553 TCTCCAAAGCGTTCCAGGAAAGG - Exonic
1023904020 7:44508458-44508480 TACCCAAAGAGGCCCAGCAAAGG + Intergenic
1024197575 7:47074024-47074046 TCCCCAAAGCTGCCCAGGTCAGG - Intergenic
1032005864 7:128301600-128301622 TACCCACGACTACCCAGGAAAGG + Exonic
1032950504 7:136904252-136904274 TACCAGAAGTTTTCCAGGAAGGG - Intronic
1034167991 7:149040426-149040448 TATCTGAAGCTTCCCTGGAAAGG - Intergenic
1034435744 7:151062073-151062095 CACCCAAGGCTGCCCAGGGAGGG - Intronic
1036966331 8:13302161-13302183 TTCAAAAAGCTTCCCAGGCAAGG - Intronic
1038167342 8:25098626-25098648 TACGAAAAGCCTCACAGGAAAGG + Intergenic
1043044560 8:75305416-75305438 TACACAGAGCTTCCCAGTAGAGG + Intergenic
1043914754 8:85908761-85908783 AGCCCACAGCTTCCCAGGTAAGG - Intergenic
1048239684 8:132729238-132729260 AAGCCAAAGCTTCCTTGGAAAGG + Intronic
1051610863 9:18960212-18960234 TACCCCACGCGTCCCAGGGATGG - Intronic
1052927868 9:34032442-34032464 GTCCCAAGGCTTCACAGGAAAGG + Intronic
1054161364 9:61673991-61674013 TACCCAAAGACTGCCAGGGAGGG + Intergenic
1057465738 9:95312796-95312818 TACCCACTTCTTCCCAGAAATGG + Intronic
1060266131 9:122112384-122112406 TACCCACAGCTGCCCTGGGAGGG + Intergenic
1060299462 9:122366422-122366444 CACCCAAATCCTGCCAGGAATGG - Intergenic
1060426458 9:123510715-123510737 TACCCACTGCTTCCAAGGATAGG + Intronic
1060586854 9:124792029-124792051 TAGGCAAAGATGCCCAGGAAAGG - Intronic
1061041290 9:128142266-128142288 TACCCTGAGCTACACAGGAAGGG + Intergenic
1190477283 X:50840557-50840579 TACCCAAAGTTTCCCAGAGAAGG - Intergenic
1190632287 X:52399642-52399664 AACACAATGCTCCCCAGGAAGGG - Intergenic
1192438854 X:71160074-71160096 TGCCCAAAGCATCCCAGAACAGG + Intronic
1201298532 Y:12486304-12486326 TACCAAGAGCCTCCCATGAATGG - Intergenic
1201951853 Y:19573911-19573933 TATCCCAAGCTTTCCAGGGAGGG + Intergenic