ID: 1144033140

View in Genome Browser
Species Human (GRCh38)
Location 17:11340346-11340368
Sequence CTGTGGGGACAGCTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 1, 1: 1, 2: 7, 3: 74, 4: 685}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144033131_1144033140 6 Left 1144033131 17:11340317-11340339 CCTGAGCTCATGCCTGTGGTTGC 0: 1
1: 1
2: 4
3: 22
4: 202
Right 1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG 0: 1
1: 1
2: 7
3: 74
4: 685
1144033132_1144033140 -6 Left 1144033132 17:11340329-11340351 CCTGTGGTTGCATTTAGCTGTGG 0: 1
1: 0
2: 0
3: 20
4: 330
Right 1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG 0: 1
1: 1
2: 7
3: 74
4: 685

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144033140 Original CRISPR CTGTGGGGACAGCTGGGGCT GGG Intronic
900157153 1:1207735-1207757 GGGTGGGGCCAGCTGGGCCTGGG + Intergenic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900423632 1:2566512-2566534 CGGTGGGGACCGCTGGGGGCTGG - Intergenic
900601986 1:3506629-3506651 CTCTGGGGCCACCTGCGGCTTGG - Intronic
900947856 1:5841288-5841310 CTGTGGGGACCGTGGGGGCAGGG - Intergenic
901066319 1:6496402-6496424 CTCTGTGGATAGCTGGTGCTGGG + Intronic
901070001 1:6512349-6512371 CAGGGGGCACATCTGGGGCTGGG - Intronic
901269710 1:7942385-7942407 CTGTCGGGAGAGCTCGTGCTGGG - Intronic
901457092 1:9369323-9369345 CTGTGAGGACGGCTGGGTCAAGG - Exonic
901536254 1:9884417-9884439 CTGTTGGGAGGCCTGGGGCTGGG - Intronic
902036037 1:13458793-13458815 CTGATGGGTAAGCTGGGGCTGGG + Intergenic
902163434 1:14550894-14550916 CTGGGGAGAGAGCTGGGGATGGG - Intergenic
902470035 1:16642900-16642922 CTCTGGGGCCAGCAGGGGCCAGG - Intergenic
902592811 1:17487246-17487268 CGGTGGGGACAGCTTGAGCCTGG - Intergenic
902631158 1:17705509-17705531 CCCTGGGGAGGGCTGGGGCTGGG + Intergenic
902631174 1:17705551-17705573 CTGGGGCTAGAGCTGGGGCTGGG + Intergenic
903141881 1:21344202-21344224 CTCTGGGCACAGCAGGGGCTGGG + Intronic
904261525 1:29290424-29290446 CTGTGGAGTCAGCAGGGGCCTGG - Intronic
904292912 1:29499156-29499178 CTGTGGAGTCAGCAGGGGCCTGG + Intergenic
904319786 1:29689445-29689467 GGGTGGGCACAGCTGGGGATGGG - Intergenic
904370435 1:30044571-30044593 CTGTGGGAAGTTCTGGGGCTGGG + Intergenic
904412352 1:30332106-30332128 CTGTGGAGTCAGCAGGGGCCTGG - Intergenic
904498493 1:30900978-30901000 CTGGGGGTGCAGCTGGGACTGGG - Intronic
904799582 1:33082842-33082864 CTGTGGGGAAAGCTGGGAATGGG - Intronic
905239270 1:36571721-36571743 GGGTGGGGACAGCTGGGCTTAGG - Intergenic
905239401 1:36572137-36572159 AGGTGGGGACAGCTGGGCCGAGG - Intergenic
905449578 1:38047622-38047644 CCGCGCGGGCAGCTGGGGCTGGG + Intergenic
905788129 1:40774242-40774264 GTCTGGGGACAGCTGGTGGTTGG + Intergenic
905866587 1:41380300-41380322 CTATGGAAACAGCAGGGGCTTGG - Intronic
906109587 1:43313732-43313754 TTGTGGGGACACCTGGGTCAGGG - Intronic
906676077 1:47694466-47694488 CTGTGGGGGCTGCAGGGGCTGGG + Intergenic
907110963 1:51925966-51925988 CTGGGGGGCCAGCTGAGGCAGGG + Intronic
907243292 1:53092409-53092431 ATGCGGGGACGGCTGGTGCTGGG - Intronic
907334882 1:53693534-53693556 CTGTGGGGGCAGCTCTGGCTGGG - Intronic
908656413 1:66393786-66393808 AGGTGGGAACAGCGGGGGCTAGG + Intergenic
910467421 1:87515207-87515229 CTTTGGGGACCTCTGGAGCTGGG + Intergenic
911487233 1:98516802-98516824 TTCTGGGTACAGCTGGGGCCTGG + Intergenic
912332758 1:108834705-108834727 GGGACGGGACAGCTGGGGCTGGG - Intronic
912575790 1:110672100-110672122 CTGTGGAAACGGCAGGGGCTGGG + Intergenic
913130494 1:115834286-115834308 CCGCTGGGCCAGCTGGGGCTAGG + Intergenic
915017098 1:152744385-152744407 CTGGAGGGACACATGGGGCTGGG - Intronic
915086670 1:153394004-153394026 CTTTGGGGACAGCAGGAGCCAGG + Intergenic
915285879 1:154851732-154851754 CTGTGGGGACAGCTCAGGTGAGG - Intronic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
916129107 1:161595351-161595373 CCGTGGGGAAGGCTGTGGCTGGG + Intronic
917650273 1:177069480-177069502 CTCTGGGGGCAGTTGGGGGTGGG + Intronic
917747882 1:178028108-178028130 CTGTGGGGAAGTCTGGGGTTTGG + Intergenic
917848912 1:179043352-179043374 CTGTGGGTGTAGCTGTGGCTGGG + Intronic
918095044 1:181327534-181327556 CTGGGGGGAAAGATGGGGGTTGG - Intergenic
919370107 1:196712772-196712794 CTGTGGGGACTGCTGTGGGGTGG - Intronic
919768221 1:201140887-201140909 ATGTGGGGAAACATGGGGCTGGG - Intronic
920054352 1:203181701-203181723 CACTGGGGACTGCTGGGGTTCGG - Intronic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
920362582 1:205429593-205429615 CTGTGGAGATAGCCGGGGTTGGG + Intronic
921756526 1:218863016-218863038 CTGTGAGGCCACCTGGAGCTTGG - Intergenic
922811245 1:228416683-228416705 TTGTGGCGTCAGCGGGGGCTGGG + Intronic
923484166 1:234413163-234413185 TTGTGGTGTCTGCTGGGGCTGGG - Intronic
924089265 1:240485853-240485875 CTGTGGGGAGCTCTGGAGCTGGG - Intergenic
1064245619 10:13665711-13665733 CTGGAAGGACAGGTGGGGCTGGG - Intronic
1066094093 10:32056266-32056288 CTGGGCGGACTGCGGGGGCTGGG + Exonic
1066586791 10:36944510-36944532 CTGCGGGGCCAACTGTGGCTGGG - Intergenic
1066821014 10:39489760-39489782 CTCTGGGGACAGTTGTGGGTTGG - Intergenic
1067201133 10:44172890-44172912 TTGTGGGGACTGCGGGGGCTTGG + Intergenic
1067342825 10:45418702-45418724 CTGTGGGCACAGGTGTGGCGAGG + Intronic
1067455253 10:46414540-46414562 CAGTGGGGAGAGCCTGGGCTTGG - Intergenic
1067686563 10:48469313-48469335 CTGTGGGGCCTGTTGGGGATGGG + Intronic
1067833478 10:49623611-49623633 CGGTGGGGATGGCTGAGGCTTGG - Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069736191 10:70656053-70656075 CAGTGTGGAGGGCTGGGGCTGGG + Intergenic
1070147516 10:73785771-73785793 CTGAGGGGCGAGCCGGGGCTGGG - Exonic
1070383849 10:75906044-75906066 CTGGGGTGAGAGCTGGGACTGGG - Intronic
1070654478 10:78262028-78262050 CTGTGAGGGCAGCTGAGGATGGG - Intergenic
1070824074 10:79380791-79380813 CCCCGGGGAGAGCTGGGGCTTGG + Intergenic
1070915109 10:80148495-80148517 CTTTGGGCCCAGCTGGGGCCTGG + Intergenic
1070964320 10:80520398-80520420 CTGTGCGGACAGCCGATGCTGGG - Exonic
1071495912 10:86167520-86167542 CTGTGGGGACAGTGGTTGCTGGG + Intronic
1071859636 10:89659068-89659090 CTTTGGGGAAAGCTGGAGATTGG - Intergenic
1072166516 10:92818593-92818615 CTATGGGGGCAGGTGGGGTTGGG + Intergenic
1072367335 10:94726345-94726367 CTGTGGGGGATGTTGGGGCTAGG - Intronic
1072438322 10:95433265-95433287 CTGTGAAGACAGCTGAGGCTCGG - Intronic
1072537885 10:96377099-96377121 CAGTGGGGTCAGGTGGGCCTCGG + Intronic
1072680343 10:97501217-97501239 CTGTGGGGACAACTGTGTGTAGG - Intronic
1072746152 10:97940617-97940639 CTGTGGGGAGGGCAGGGGCCTGG + Intronic
1073189994 10:101644290-101644312 TGGTGGGGGCAGCTGGGACTGGG + Intronic
1073443168 10:103564767-103564789 CAGAGGGGACAGCTGGAGGTGGG - Intronic
1073510625 10:104040369-104040391 CTGGGGGGCCAGGTGGGCCTGGG + Exonic
1074618259 10:115092675-115092697 TTGTGGGGTCAGCGAGGGCTGGG - Intergenic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075465678 10:122648627-122648649 CCGTGGGGCCAGCTGGGGTGTGG - Intergenic
1075704933 10:124494842-124494864 CTGTGGAGCAGGCTGGGGCTGGG + Intronic
1075815855 10:125264328-125264350 GTTTGGGGAGAGCTGGTGCTGGG + Intergenic
1076140830 10:128077543-128077565 CTGAGAGGGCAGATGGGGCTGGG + Intronic
1076184512 10:128435774-128435796 CTATGGGGTCAGCTGGGTCCTGG - Intergenic
1076522734 10:131091025-131091047 CTGTGGGCAGGGGTGGGGCTGGG + Intergenic
1076742322 10:132492735-132492757 CAGTGGGAACAGCTGGAGCCAGG - Intergenic
1076801947 10:132835011-132835033 CTGTGGGGACAGCCGGGCCCAGG + Intronic
1076815220 10:132911256-132911278 CAGTGGGGACGGCTGGCCCTGGG - Intronic
1076913124 10:133402239-133402261 CTGTGTGGTGAGCCGGGGCTGGG + Exonic
1077022854 11:426932-426954 CTGGGAGGCCAGCTGGGGTTGGG - Intronic
1077069154 11:659955-659977 AGGTGGGGCCAGGTGGGGCTTGG + Intronic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1077207087 11:1349892-1349914 CTCTGGGAACAGCTGGGGAAAGG - Intergenic
1077298039 11:1835135-1835157 CTGTGGTGCCAGCTGGGGCCGGG - Exonic
1077336873 11:2009266-2009288 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1077478655 11:2802883-2802905 CTGTAGGGTCTGCTGGGGCTGGG - Intronic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1078903218 11:15660929-15660951 CTATGGGAAGAGCTGGGGCTGGG - Intergenic
1079224724 11:18595440-18595462 ATGTGGGGTCAGGTGGGGGTGGG - Intergenic
1079369904 11:19842665-19842687 CTCCAGGGACAGCTGGGGCAAGG - Intronic
1079690098 11:23406641-23406663 CTGTGGGGCCCGCTGGAGCCTGG + Intergenic
1080324778 11:31057957-31057979 CTGTGGGGACAGCTCTGTGTGGG + Intronic
1080654207 11:34245835-34245857 CTTTGGGGACAGCTTTGGATTGG - Intronic
1080897116 11:36456033-36456055 CTGTGGAGAGAGCAGGGCCTTGG + Intronic
1081567650 11:44269893-44269915 CTGTGGGGGAAGCTGGGGGGAGG + Intronic
1081603595 11:44512725-44512747 TTTGGGGGAAAGCTGGGGCTGGG + Intergenic
1081630778 11:44688252-44688274 CTGCGTGGGCAGCTGGGGCCAGG - Intergenic
1081807095 11:45896646-45896668 CGCTGGGAAGAGCTGGGGCTGGG + Intronic
1083185788 11:61017218-61017240 CAGGAGGGACAGCTGGGGCTGGG + Intronic
1083617152 11:64031956-64031978 CTGTGGGGAAGGCTGAGGCCAGG + Intronic
1083627667 11:64079789-64079811 CTGGAGGTACAGCTGGGTCTGGG + Intronic
1084009886 11:66341506-66341528 GCGTGGGGACACCTTGGGCTGGG - Intronic
1084068343 11:66718402-66718424 CTGTGGGGACGACTGTGCCTGGG - Intronic
1084530806 11:69726772-69726794 CTATGGGGAGCGCTGGCGCTGGG + Intergenic
1084609569 11:70193617-70193639 CTATGGGGGCAGCTGAGGCTGGG + Intergenic
1084947438 11:72646115-72646137 CTGGGAGGAAAGCTGGGGCTGGG - Intronic
1084960233 11:72712635-72712657 CTGTGTGGACAGAGGGGGCGTGG - Intronic
1085301531 11:75461822-75461844 AGTTGGGGACAGCTGGGGCTTGG - Intronic
1085319200 11:75563861-75563883 CTGTGGGCACAGCCCTGGCTAGG + Intronic
1085331135 11:75652368-75652390 CAGAAGGGACAGCTGGGGCATGG - Intronic
1085340992 11:75731454-75731476 CCAAGGGGTCAGCTGGGGCTAGG + Exonic
1086952766 11:92908075-92908097 CTGTAGGGTCAACTGGGGTTTGG - Intergenic
1087239259 11:95757125-95757147 CTGTGGGGGCAGATGGGGACTGG + Intergenic
1088830605 11:113533158-113533180 CTGTGGGGCCACGTGGGGGTGGG - Intergenic
1089078731 11:115759619-115759641 CTGTGTGGAGGGCTGGGGTTTGG + Intergenic
1089185572 11:116612436-116612458 CTGTGGGGAGAGCTGGAGACAGG + Intergenic
1089195578 11:116692452-116692474 CTGGGGGGACGGCTGGGGAGGGG - Intergenic
1089519886 11:119056711-119056733 CTGTGGGCACAGCGGGGCCGGGG - Intronic
1089844158 11:121445456-121445478 CTGTGGGGACAGCAGAAGCTGGG - Intergenic
1090210985 11:124921068-124921090 CCCGGGGGAAAGCTGGGGCTGGG - Exonic
1202819857 11_KI270721v1_random:64448-64470 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1091748751 12:3009890-3009912 CTGGGGGGTCAGCTTGGCCTTGG + Intronic
1091801541 12:3327772-3327794 CTGTGTTGACAGCTGGGGGGAGG + Intergenic
1091995272 12:4988285-4988307 TGGTGGGGTCAGCTGGGGATTGG - Intergenic
1092112834 12:5976110-5976132 CTGTGAGGACAGCTGTCGGTCGG - Exonic
1092861725 12:12724837-12724859 CTGCGGGCCCAGCTGGGGGTGGG + Intergenic
1092936303 12:13367254-13367276 CTGTAGGGCCAGGTGGGGCCTGG - Intergenic
1094107928 12:26833202-26833224 CTGAGGGGACCGAGGGGGCTCGG - Intergenic
1096191270 12:49621826-49621848 CTGTGGGGAGGGCTGCAGCTGGG + Intronic
1096553222 12:52387983-52388005 CTGTGGGAAGAGATGGGCCTGGG - Intergenic
1096676104 12:53227029-53227051 TTGTGTGGGCAGCTGGGGGTGGG - Intronic
1098206816 12:68119480-68119502 AGTTGGGGACAGCTGAGGCTTGG - Intergenic
1100284529 12:93152647-93152669 CTGTGGAGACATGTGGGGCCAGG - Intergenic
1101017738 12:100519369-100519391 CTGTGGGGCTGGGTGGGGCTTGG + Intronic
1101970102 12:109307059-109307081 CTGTGTGCAGAGCTGGGGCCAGG - Intronic
1101972960 12:109329892-109329914 CTGTGGGTACAGCTGTGGATAGG + Intergenic
1102223390 12:111210055-111210077 TGGTGGGGCCAGCAGGGGCTGGG + Intronic
1102259542 12:111435864-111435886 CTATGGGGACAGCTGGGAGCAGG + Intronic
1102439076 12:112947955-112947977 ATGTGGGGTCAGCTGGGTCCAGG - Exonic
1102764461 12:115420400-115420422 GTTTGGGGTCAGCTGGGCCTTGG - Intergenic
1103004248 12:117408752-117408774 GCGTGGGGACAGCTGGGCCCAGG - Intronic
1103344884 12:120242552-120242574 CTCTGTGGTCAGCTGGGGCTGGG - Intronic
1103598984 12:122042132-122042154 CTGGGGGCAGAGCTGGGGCCCGG - Intronic
1103704341 12:122863198-122863220 CTGTGGAGGCAGCTGGCTCTTGG - Intergenic
1103713581 12:122930172-122930194 CTGCGGGGACAGTGGGGGCCTGG + Intronic
1103870176 12:124085682-124085704 CTGAGGGGGCAACTGGAGCTCGG - Intronic
1104299387 12:127550483-127550505 CTGTGGGAACACCTAGGGCAGGG + Intergenic
1104733945 12:131124565-131124587 CTGTGGGGCCTGCTGGGCCTAGG + Intronic
1104734994 12:131131163-131131185 CTGTTGGGACCTATGGGGCTGGG - Intronic
1104785049 12:131443887-131443909 CTGTGGGGGATGCTGCGGCTGGG + Intergenic
1104921227 12:132291793-132291815 GTGTGGGGACAGGAGGGGATGGG - Intronic
1105810802 13:23993598-23993620 CTGTGGGAAGGGCTGGGGCATGG - Intronic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1106247155 13:27960408-27960430 CTCTGGGAAGAGATGGGGCTTGG - Intergenic
1106564201 13:30871132-30871154 CTGAGAGGACAGCGGGGGCCTGG + Intergenic
1107908637 13:45084935-45084957 CTATGGTGACGGCTGTGGCTAGG + Intergenic
1108482168 13:50884491-50884513 CTGTGGGGAGCTCTGGAGCTGGG + Intergenic
1108597371 13:51961067-51961089 CCTTGGGGACTGCTGTGGCTTGG - Intronic
1109219123 13:59623646-59623668 TCGTGGTGTCAGCTGGGGCTTGG + Intergenic
1110086271 13:71384716-71384738 CTCTGGGGACTGCTGTGGGTGGG - Intergenic
1112569262 13:100579311-100579333 CTGTGGGGAGAGGAGGGCCTAGG + Intronic
1112899174 13:104338389-104338411 CTGTGGAGTAAGGTGGGGCTGGG - Intergenic
1113229188 13:108194502-108194524 CTGTGGAGCCAGCAGGGGCCGGG + Intergenic
1113395063 13:109939953-109939975 CTGTGTGGTCAGCGGGGGGTTGG + Intergenic
1113764041 13:112869802-112869824 CTCTAGGAACAGCTGTGGCTTGG - Intronic
1113769610 13:112899665-112899687 GTGTGAGGACACCTGGGGCCAGG - Intronic
1113786017 13:113002430-113002452 TTGTGGGGACAGCAGTGGCCAGG - Intronic
1113814154 13:113159901-113159923 CTGTGGAGACGGACGGGGCTGGG + Intronic
1113913918 13:113859977-113859999 CTTTGGGAACAGCTGGGGAAGGG - Intronic
1113920406 13:113905049-113905071 CTGAAGGGCCTGCTGGGGCTCGG - Intergenic
1114734721 14:25032584-25032606 CTGTGGTGACAGTTGGCTCTTGG - Intronic
1115501555 14:34054226-34054248 GTGAGGGGAGAGTTGGGGCTGGG - Intronic
1115997801 14:39211896-39211918 CTGTGGCGACAGCTGCTGCCAGG + Intergenic
1116589467 14:46752536-46752558 CTGTGGTGACAGCTAGAGCTGGG - Intergenic
1116692376 14:48125832-48125854 CTGTGTGGACAGCTGGTTCAGGG + Intergenic
1117038352 14:51748979-51749001 ATGTGGGTCCAACTGGGGCTGGG - Intergenic
1117300833 14:54425467-54425489 CTGTGGGTTCAGCTGAGGCATGG - Exonic
1117460500 14:55940289-55940311 ATGTGGGGACAGGCTGGGCTGGG - Intergenic
1117533997 14:56686824-56686846 TTTTGGGGACAGATGGGGCCAGG - Intronic
1118390092 14:65288387-65288409 TTGGGGGGACAGCTGTGGCCAGG + Intergenic
1118753503 14:68822685-68822707 CTGTGGGGTCAGCTAGGGCAGGG - Intergenic
1118867411 14:69714313-69714335 CTGAGGGCTCAGCTGGGACTGGG - Exonic
1119083353 14:71717766-71717788 CTCTGGGCACAGCTGTGGGTGGG - Intronic
1119190967 14:72681425-72681447 CTCTGGGGCCAGCTGAGCCTGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1120827644 14:88969915-88969937 CAGTGGCCAGAGCTGGGGCTTGG - Intergenic
1121333309 14:93061433-93061455 CCATGGGCACAGCTGCGGCTAGG + Intronic
1122603690 14:102933761-102933783 CTGTGGGGGGAGTTGGGGCTCGG + Exonic
1122853423 14:104548642-104548664 CTGGGGAGAACGCTGGGGCTGGG - Intronic
1122853452 14:104548714-104548736 CTGGGGAGAATGCTGGGGCTGGG - Intronic
1122871557 14:104641187-104641209 CAGTGGGGACGGTGGGGGCTGGG - Intergenic
1123039958 14:105486451-105486473 CTGCGGGGGCTGCGGGGGCTGGG - Intergenic
1123410693 15:20056462-20056484 CTGTGGGGACAAGTGGTCCTAGG - Intergenic
1123520022 15:21063168-21063190 CTGTGGGGACAAGTGGTCCTAGG - Intergenic
1123722754 15:23074161-23074183 CAGTGGGGATAGCTGTGGTTTGG - Intergenic
1123888683 15:24752588-24752610 CTGTGGGGTCTGCAGGGGCAAGG + Intergenic
1124138816 15:27059255-27059277 CTTTGGGGAGAGCTGAGTCTTGG + Intronic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1124340988 15:28889001-28889023 CTGTGTGCCCAGCGGGGGCTGGG + Intronic
1124844698 15:33279115-33279137 CTGACGGGACAGGTGAGGCTGGG + Intergenic
1125186582 15:36938170-36938192 CTTTGGTGACAGCGGGTGCTTGG - Intronic
1125519649 15:40340704-40340726 AGCTGGGGACAGCTGGGGCTGGG - Intronic
1125602440 15:40923046-40923068 CTGAGGGGGAAGGTGGGGCTGGG + Intergenic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127447205 15:59076153-59076175 CTGTGGAGGGGGCTGGGGCTGGG - Exonic
1128229335 15:66023958-66023980 GGATGGGGACAGCTAGGGCTGGG + Intronic
1128229954 15:66027521-66027543 CAGAGGGGAAAGCTGGGGCTTGG - Intronic
1128316259 15:66661372-66661394 ATGTGGGGAGGGCTGGGGCCTGG - Intronic
1128388138 15:67165107-67165129 CTGTGGGGACAGCAGGTGCCAGG + Intronic
1129249702 15:74302215-74302237 GGGTGGGGACAGCTGGGGAAGGG - Intronic
1129462415 15:75706225-75706247 CTGGGGAGACAGAGGGGGCTGGG - Intronic
1129496125 15:75982826-75982848 GTGGGGAGACAGCTTGGGCTTGG - Intronic
1129677771 15:77641710-77641732 CTGTGGAGTCAGGTGGTGCTGGG + Intronic
1129720171 15:77873509-77873531 GTCTGGTGACAGCTGGGGCCAGG + Intergenic
1129737658 15:77975064-77975086 CTCTGGGGGCAGCAGTGGCTGGG - Intergenic
1129855826 15:78824441-78824463 CAGTGAGGATGGCTGGGGCTAGG - Intronic
1131462774 15:92630405-92630427 CTGTCGGGTCCTCTGGGGCTTGG - Intronic
1132464904 16:72783-72805 CTGCGGGGACACCTGGGGCTGGG + Intronic
1132626368 16:893579-893601 CTGTGAGGACTCCTGGGGCACGG + Intronic
1132730350 16:1357958-1357980 CTGTGGGGAAGGCTGGGGCTTGG - Intronic
1132898245 16:2238904-2238926 CTGTGAGCACAGCTGGGACAGGG + Intergenic
1132909276 16:2299972-2299994 CTGTGGGGACAGGGAGGGCCGGG - Intronic
1133144075 16:3770663-3770685 CTGCGGGGTCACCTGGGCCTGGG + Exonic
1133238948 16:4403396-4403418 CTGTGCTGACAGGTGCGGCTTGG + Intronic
1133272433 16:4616733-4616755 CTGTGAGAACGGCTGGGGTTGGG + Intronic
1134039483 16:11057440-11057462 CTGTGGCTCAAGCTGGGGCTTGG - Intronic
1134220152 16:12347363-12347385 CTGTGGGGACGGCTGGCCCCAGG - Intronic
1135302022 16:21338635-21338657 GTGTGGGGCCAGATGGGCCTCGG + Intergenic
1135810712 16:25584379-25584401 CTGTGGGGACTGTTGGGGGGTGG - Intergenic
1136230026 16:28880418-28880440 CGGTGGCAACAGCTGGGGCGGGG + Intronic
1136361145 16:29780524-29780546 GTGTGGGGGCATCTGTGGCTGGG + Exonic
1137038923 16:35591854-35591876 CTGTGGGCCGAGCTGGGACTTGG + Intergenic
1137251798 16:46746796-46746818 CGGTGCAGACAGCGGGGGCTAGG + Intronic
1137671418 16:50281712-50281734 CTCTGGGGACAGAGAGGGCTGGG + Intronic
1138081271 16:54093526-54093548 GAGTGGGGTCAGCTGGGACTGGG - Intronic
1138277131 16:55743234-55743256 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138283021 16:55786413-55786435 CTCTGTGGACAACTGGAGCTGGG + Intergenic
1138597265 16:58035686-58035708 CTCTGGGGACAGGTGGAGCTAGG - Intronic
1138766540 16:59612276-59612298 CTGTCGGAACTGCTGGGGCGGGG - Intergenic
1139015375 16:62683832-62683854 CTGTGGAGCCAGCAGGGGCTGGG + Intergenic
1139311517 16:66031979-66032001 CTGTGCAGAGAGCTGTGGCTGGG - Intergenic
1139423555 16:66864486-66864508 CGGTGGGGACATGTGGGGCTTGG - Intronic
1139507090 16:67404200-67404222 ATGTGGGGAGAGGTGGGGCGGGG + Intronic
1139511922 16:67432467-67432489 CTGTGTGATCAGATGGGGCTGGG + Intronic
1139604646 16:68009470-68009492 CAGCTGGGACAGCTGGTGCTGGG - Intronic
1139911343 16:70399291-70399313 CTGTGGGGTCCTCTGGCGCTGGG + Exonic
1140315361 16:73891223-73891245 CTGGGGGGAGAGGTGGGGATTGG - Intergenic
1140469583 16:75206710-75206732 ATGTGTGGGCAGCTGGGGCTTGG - Intronic
1141684304 16:85561671-85561693 CTCCGGGGGCAGCTGGGGCCGGG - Intergenic
1141840116 16:86568552-86568574 CTGCGGCGTCGGCTGGGGCTGGG - Exonic
1141887828 16:86904912-86904934 TTGTGGGGAGAGCTGGAGCGGGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142122117 16:88391621-88391643 CTCTTGGGACAGGTGGGGCCGGG + Intergenic
1142160751 16:88556159-88556181 CAGTGGGGGCAGCAGGGCCTTGG - Intergenic
1142187712 16:88702293-88702315 CTGTGGGGACAGCTGAGCTGCGG + Intronic
1142189850 16:88712779-88712801 CTGGGGGTCCAGCGGGGGCTGGG - Exonic
1142258060 16:89024851-89024873 CTGTGTGCACAGGTGGGCCTCGG - Intergenic
1142416261 16:89944627-89944649 TTGTGGGGACAGGTGGGGGACGG - Intergenic
1142848680 17:2694100-2694122 GTGTGTGGCCAGGTGGGGCTGGG - Intronic
1143388683 17:6547428-6547450 TAGGGGGGACAGCTGGGCCTTGG - Intronic
1143514395 17:7412095-7412117 TTGTGGGGAAAGATGGGGGTCGG - Intronic
1143698010 17:8634692-8634714 CTGTGGTGAGGACTGGGGCTGGG + Intergenic
1143698139 17:8635835-8635857 CTGTGGTGAGGACTGGGGCTGGG + Intergenic
1143727155 17:8856987-8857009 CTGTGGGGAAAGCTGGGGGAAGG - Intronic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1144834378 17:18149219-18149241 GTTTGGGAACAGCTGGGACTCGG + Exonic
1145013465 17:19382485-19382507 CCATGGGGACACCTGGGTCTGGG + Intronic
1145242077 17:21245901-21245923 CAGTGGCCACAGCTGGGCCTTGG - Intronic
1146056681 17:29584871-29584893 CTGTGGGCAGAGCTCAGGCTGGG - Intronic
1146521536 17:33529130-33529152 CTTTGGGGACATCTTGGGTTTGG + Intronic
1146677871 17:34785930-34785952 GGGTGGGGACTTCTGGGGCTGGG - Intergenic
1146937931 17:36824133-36824155 CTTTGGGGCCAGCAGGGGCAGGG - Intergenic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1147364752 17:39952674-39952696 CTGTGGGGCCATCTTGGGCCCGG - Intergenic
1147608864 17:41789696-41789718 CTGTGCAGACAGCTGAGTCTAGG - Intergenic
1147653300 17:42073985-42074007 CTGAGGGGAGAGCAGGGGCAAGG - Intergenic
1147864835 17:43545495-43545517 CTGTGGTGAGAGTAGGGGCTGGG + Intronic
1147961608 17:44170957-44170979 CTTGGTGGACAGCTGGGTCTCGG - Exonic
1148050462 17:44767655-44767677 GTGCCGGGGCAGCTGGGGCTGGG - Intronic
1148129454 17:45254268-45254290 CTCTGGGGGCAGGTGGAGCTGGG + Intergenic
1148178130 17:45585029-45585051 CAGTGGGGGCGGCTGGGGCCGGG + Intergenic
1148612580 17:48974144-48974166 TAGTGGGGACAGGTGGAGCTGGG - Intergenic
1148761113 17:50001086-50001108 GTGTGGGGAGAGCTGGGGGGAGG + Intergenic
1148808969 17:50278580-50278602 CTGTGGTGACAGCTGCTGCCAGG + Exonic
1149302555 17:55318401-55318423 ATGTGTGGACAGGTGAGGCTGGG + Intronic
1149395059 17:56231897-56231919 TTGTGAGGACAGCTAGGGGTGGG - Intronic
1149545467 17:57500324-57500346 CTTTGGGGGCAGGTGGGACTTGG + Intronic
1149686546 17:58538817-58538839 CTGGGTGAACAGCTGGGGATGGG - Intronic
1151263079 17:72931944-72931966 CTGTGGTGAGAGCAGGGCCTGGG - Intronic
1151352696 17:73541155-73541177 CTGTGAGGACAGCTCTGGCTGGG + Intronic
1151786154 17:76275998-76276020 CTGTGGGAACCCCTGGGGGTGGG + Intronic
1151941597 17:77295766-77295788 CGGTGGGGGCAGCTGGTGCCGGG - Intronic
1152009222 17:77700663-77700685 AGCTGGGGACGGCTGGGGCTGGG + Intergenic
1152365667 17:79854915-79854937 CTGTGGGATCAGCAGGGACTGGG + Intergenic
1152477150 17:80525899-80525921 CTGTGGGTACAAGTGGGGCAGGG - Intergenic
1152521469 17:80859089-80859111 CTGTGTGGCCGGCTGGGGCTCGG + Intronic
1152580780 17:81164811-81164833 CTGTAGTGACCCCTGGGGCTCGG - Intronic
1152637549 17:81436304-81436326 CTCTGGGGGCAGCTGCGGGTGGG - Intronic
1152694138 17:81735313-81735335 CTCTGGGGACCGCAGGGGCTGGG - Intergenic
1152744850 17:82033920-82033942 CTGTGGGGAGCGGTGGGGGTGGG + Exonic
1152795504 17:82304311-82304333 CTGAGGGGGCCCCTGGGGCTGGG + Intergenic
1153545891 18:6204349-6204371 CTGTGGCTACTGCTTGGGCTGGG + Intronic
1155074187 18:22340734-22340756 CTGTGGGGACAGACGGCACTGGG + Intergenic
1156424725 18:36997855-36997877 CTGTGGTGTCAGCTGGGCATGGG + Intronic
1156500996 18:37558244-37558266 CTGTGGGTAGGGCTGTGGCTTGG + Intronic
1157009254 18:43627116-43627138 CTATGAGGAGAGCTGGGGTTAGG + Intergenic
1157518270 18:48326782-48326804 CTATGGGGACAACAGGGGCAGGG + Intronic
1157564165 18:48668506-48668528 TTGTGGGGACAGCCGGGGGCCGG + Intronic
1157589622 18:48828703-48828725 CTGTGGGGAGAGAAAGGGCTGGG - Intronic
1157621947 18:49021750-49021772 CTGTGGGGACAGCAAGGTGTAGG - Intergenic
1157876231 18:51276227-51276249 CTGTCGGCTCAGCTGGGGCCAGG + Intergenic
1157895685 18:51464650-51464672 CTGGGAGGACAGCAGGAGCTTGG + Intergenic
1158004954 18:52661639-52661661 CTGTGTGCACAAGTGGGGCTGGG - Intronic
1158036945 18:53043298-53043320 CAGTGGGGCCTGCTGGGGGTTGG + Intronic
1158112152 18:53952136-53952158 CTCAGGGAACAGCTGGTGCTGGG + Intergenic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1160005156 18:75063834-75063856 CTGTGGGAACATCTGGATCTCGG - Exonic
1160223323 18:76992798-76992820 GTGGGAGGAGAGCTGGGGCTGGG - Intronic
1160529181 18:79553623-79553645 GCGTGGGGACAGCTGTGGCATGG - Intergenic
1160572694 18:79829740-79829762 CTGTGTGGAAAGCTGGTGCCGGG + Intergenic
1160664754 19:320515-320537 CTGTGCGGCCAGCTGTGGCCTGG - Intronic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1160857694 19:1224698-1224720 CTGGGAGGAGAGCAGGGGCTGGG + Intronic
1160862986 19:1245429-1245451 GTGTGTGGACGGCGGGGGCTGGG + Intergenic
1161044814 19:2129164-2129186 CTGTGGGGACAGCAGGGCCTCGG + Intronic
1161321121 19:3641989-3642011 CTGTGGTGCCAGCAGGGCCTGGG + Intronic
1161378126 19:3950471-3950493 CTGTGGGCCCAGCTAGGGCCTGG + Intergenic
1161534551 19:4811035-4811057 ATGTGGAGACAGCTGGGAATGGG + Intergenic
1161572024 19:5036013-5036035 CTGTGGGGACAGATGGGCTCAGG + Intronic
1161574809 19:5049380-5049402 CAGGGGAGACAGCTGGGGCGGGG + Intronic
1161939675 19:7394810-7394832 CTGAGGGGACAGCTGGGTTGCGG - Intronic
1161975894 19:7607639-7607661 CTGTGGGGTCCCTTGGGGCTGGG + Intronic
1162059331 19:8085453-8085475 CTGTGGGGGTGGCCGGGGCTGGG - Exonic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1163150944 19:15413678-15413700 CAGTGGAGACCGCAGGGGCTGGG - Intronic
1163152266 19:15422514-15422536 CTGTGGGGCCTGCTGGGGCCTGG - Exonic
1163170784 19:15529652-15529674 CAGTGGGGGAAGCTGGGGCTGGG + Intronic
1163463733 19:17454742-17454764 CTCTGGGGGCAGGAGGGGCTGGG - Intronic
1163582645 19:18147602-18147624 CTGCTGGGACATCAGGGGCTGGG - Exonic
1163691699 19:18742028-18742050 CCGTGAGGAGAGGTGGGGCTGGG - Intronic
1163753435 19:19092324-19092346 CACTGAGGGCAGCTGGGGCTGGG - Intronic
1163826637 19:19527984-19528006 CTGTGGGGACAGTGGGGTATGGG - Intronic
1164200742 19:23016121-23016143 CTGTGGGAAGATCTAGGGCTAGG + Intergenic
1164321074 19:24147683-24147705 CTCTGGGGACTGTTGTGGCTTGG - Intergenic
1165258698 19:34595810-34595832 AGGTGGGGACAGCTGGGGGTGGG + Exonic
1165360628 19:35334631-35334653 CCTTGGGGAGAGCTGAGGCTGGG + Intronic
1165927489 19:39335934-39335956 CTATGGGAAGAGCTGGGGCTGGG - Intronic
1166250305 19:41565108-41565130 CTGGGAGGCCAGCTGTGGCTGGG + Intronic
1166714928 19:44960890-44960912 CTGAGGGGACAGCTGGGAGGAGG + Intronic
1166732863 19:45068415-45068437 CTGAGGCGTCAGCTTGGGCTGGG - Exonic
1166873621 19:45884707-45884729 CTCTGGGTACTGCTGGGGCAGGG + Exonic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167257983 19:48442643-48442665 CTGTGGCGGCGGCGGGGGCTTGG - Exonic
1167619822 19:50554538-50554560 ATCTGGGGACAACTGGGGCCAGG - Intronic
1167764246 19:51469600-51469622 CTCTGGGGACATCTGAGGCATGG + Intergenic
1168113859 19:54209827-54209849 CTGAGGGGACAGCAGGCTCTGGG + Intronic
1168139312 19:54374695-54374717 CTCTGGGAACCTCTGGGGCTGGG - Intergenic
1168158705 19:54493546-54493568 CTCTGGGAACCTCTGGGGCTGGG + Intergenic
1168240270 19:55085725-55085747 CTGGGGGCACAGCAGGGGCCGGG - Intronic
1168255157 19:55161023-55161045 CTGGGGGTAGAGGTGGGGCTGGG - Intronic
925379367 2:3414543-3414565 CAGCGGGGACAGCTGGGGGATGG - Intronic
925409399 2:3631467-3631489 CACTGGGCACAGCTGGGCCTGGG - Intronic
926084003 2:10009866-10009888 CTGTTGGGACAGCAAGGGCTGGG + Intergenic
926157157 2:10462666-10462688 CTGTGTGCAGAGCTGGGGCTGGG - Intergenic
926333709 2:11847746-11847768 CTGTGAGGGCAGTTGGGCCTTGG + Intergenic
926425584 2:12736093-12736115 ATGTGGGGACACCTGGGGGCAGG + Intronic
926515048 2:13832962-13832984 CAGTGGGGCCTGCTGGGGCAGGG + Intergenic
926770505 2:16369103-16369125 CTGTGGGGTCAGCTATTGCTAGG - Intergenic
926947427 2:18203497-18203519 ATGTGGGAACAGCTAAGGCTTGG - Intronic
927518875 2:23687542-23687564 CTGTGGGCTCAGCTGGTGTTTGG - Intronic
927962740 2:27250810-27250832 CTGTGTAAAGAGCTGGGGCTGGG + Intergenic
929040668 2:37741683-37741705 CTCTGGGAACACCTGTGGCTGGG - Intergenic
929050017 2:37828487-37828509 CAGTGGGGACAGCTGAAGCCGGG + Intergenic
930098028 2:47581872-47581894 CTGTGAGGTCATTTGGGGCTGGG + Intergenic
932308250 2:70719144-70719166 CAGTGGTGACAGCTGGTGGTGGG + Intronic
932467844 2:71934956-71934978 CTGTGGGCCCAGCCTGGGCTTGG + Intergenic
932567200 2:72917563-72917585 GTGCGGGGACACCGGGGGCTGGG + Exonic
932598394 2:73108252-73108274 CTGTGGGTTCAGCTTGGGTTGGG - Intronic
932698317 2:73975637-73975659 CTGTGGGCACTCCTGGGGCAAGG - Intergenic
933006328 2:77000201-77000223 CTGTGGGGACAGCTGGACACAGG + Intronic
933155399 2:78967518-78967540 TTGTGGGGAAAGCTGGGTCAAGG + Intergenic
933676976 2:85065686-85065708 CTTTGGGGAAATATGGGGCTAGG + Intergenic
934898974 2:98142068-98142090 CTGTGGGTAAAGCTCGGGATGGG - Intronic
935426479 2:102923972-102923994 ATCTGGGGTCAGCTGGGGGTTGG + Intergenic
935788580 2:106570796-106570818 CTGAGGGAAAAGGTGGGGCTCGG + Intergenic
937345155 2:121120963-121120985 CTGTGGGGAGAACTGGGGGAGGG - Intergenic
937923003 2:127145629-127145651 CTGTGGGGCCAAGAGGGGCTGGG + Intergenic
938306002 2:130254249-130254271 CCCTGCGGACAGCAGGGGCTGGG + Intergenic
938448150 2:131393523-131393545 CCCTGCGGACAGCAGGGGCTGGG - Intergenic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
940422929 2:153499876-153499898 CTGGGTGCACAGCTGCGGCTGGG + Intergenic
942326547 2:174781286-174781308 CTATGGGTACCGCTGGTGCTGGG + Intergenic
943313056 2:186351808-186351830 CTGTGGGATCAGCTAAGGCTAGG + Intergenic
943864834 2:192916372-192916394 CTCTGGGGACTGCTGTGGGTTGG + Intergenic
945103901 2:206289759-206289781 CTGTGGGGACTGCAGGGGTGAGG + Intronic
946161644 2:217839379-217839401 CTGTGTGGAACCCTGGGGCTGGG - Intronic
946405369 2:219489436-219489458 GTGTGGGGGCAGCAGGAGCTAGG - Exonic
946999528 2:225437815-225437837 CTATGGAGTCAGATGGGGCTAGG - Intronic
947134290 2:226961636-226961658 CTCTGGGGTCAGTTAGGGCTTGG - Intronic
947764011 2:232624295-232624317 CTGGGGGGCAAGCTGGGGCTGGG - Intronic
947903941 2:233745923-233745945 CAGAAGGGACAGCTGGGGGTTGG + Intronic
947905344 2:233757278-233757300 CAGAAGGGACAGCTGGGGGTTGG + Intronic
948282673 2:236760084-236760106 CTGGGGCTACAGCTGGAGCTGGG - Intergenic
948567940 2:238898243-238898265 CAGAGGGGTCAGCTGAGGCTGGG - Intronic
948669063 2:239555014-239555036 TTGTGGGCTCAGCTAGGGCTGGG - Intergenic
948794673 2:240396205-240396227 CTGTGGGGAGGGCTGCAGCTGGG - Intergenic
948858649 2:240742473-240742495 CTGTGGGAACAGGTGGGTCATGG - Intronic
948861344 2:240754162-240754184 AGGTGGGGACTGCTGGGGGTGGG + Intronic
948887274 2:240890563-240890585 CTGTGGGCATAGGCGGGGCTGGG - Intronic
949055230 2:241924487-241924509 CTGTGGGAAGGGCTGGGGCCAGG + Intergenic
1169065920 20:2693951-2693973 CTGTGGGGCGGGCTGGGGCGGGG + Intronic
1169343546 20:4813366-4813388 CTGTGCAGACAGCTTGGGCAGGG - Intronic
1170075831 20:12417735-12417757 CAGTGCAGACAGCAGGGGCTGGG - Intergenic
1171245326 20:23606140-23606162 GTGCTGGGGCAGCTGGGGCTGGG - Intergenic
1171409214 20:24934824-24934846 CTCTGGTGCCATCTGGGGCTTGG - Intergenic
1171489257 20:25504964-25504986 GTGTGGGAAGAGCTGGGGGTGGG - Exonic
1171723015 20:28584301-28584323 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171755069 20:29099151-29099173 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1171787618 20:29483741-29483763 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1171860336 20:30395640-30395662 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
1171946971 20:31387605-31387627 CTGTGGGCAGAGCTAGGGATGGG - Intronic
1172115371 20:32570507-32570529 CTGTGGGGACAGGAGGGGGAAGG - Intronic
1172273900 20:33669583-33669605 CTGATGGGACAGGTTGGGCTGGG - Intronic
1172615100 20:36278097-36278119 CTCTGAGGGCACCTGGGGCTTGG + Intergenic
1172633451 20:36393933-36393955 CTGTGTGTACAGCAGGGCCTGGG - Intronic
1172877196 20:38171807-38171829 CAGAGGGGACAACTGAGGCTTGG - Intergenic
1173159669 20:40643117-40643139 CTCTGGGGCCAGATGGGGCTGGG + Intergenic
1173250150 20:41360099-41360121 CTGTGGGGGAAACTGAGGCTGGG + Exonic
1173880382 20:46407035-46407057 CAGTGGGGATAGCTGTGGTTTGG + Intronic
1174081224 20:47971991-47972013 CTGCGGGATCAGCTGGGTCTGGG - Intergenic
1174135276 20:48374897-48374919 CTGCGGGATCAGCTGGGTCTGGG + Intergenic
1174398347 20:50261532-50261554 CTGTGGGGTCAGATGGGCTTGGG + Intergenic
1175260770 20:57672832-57672854 CCATGGGGAGAGCTGGGGGTTGG - Intronic
1175323684 20:58107695-58107717 CTGAGGGGTCAGCAGGGGCCAGG - Intergenic
1175400986 20:58699744-58699766 CAGTGGGGAAAGGTGGGTCTGGG - Intronic
1175472416 20:59240113-59240135 CTGTGGGGGTAGGTGGGGGTGGG - Intronic
1175499349 20:59438891-59438913 CTGGCTGGACAGCTGGGGCCAGG - Intergenic
1175755326 20:61525923-61525945 CTGTGGGGACAGCTCAGCGTTGG + Intronic
1175989242 20:62779298-62779320 CTGTGGGGGCTGCAGGGGGTGGG - Intergenic
1176128111 20:63485034-63485056 CTCTGGGGAGGGCAGGGGCTTGG - Intergenic
1176199825 20:63855252-63855274 CTGTGGCCACAGCTGGGGGGAGG - Intergenic
1177723370 21:24936213-24936235 ATGTGTGTACAGCTGGTGCTGGG + Intergenic
1178087443 21:29126139-29126161 CTGTGGGGGGAGCTGTGCCTTGG + Intronic
1178692327 21:34760334-34760356 CTATGGGCTCAGCTGGGGCATGG - Intergenic
1179154200 21:38835748-38835770 CAGTTGGGAGGGCTGGGGCTGGG - Intergenic
1179308225 21:40174161-40174183 TTGTGGGGGCTGCTGGTGCTAGG + Intronic
1179879160 21:44286312-44286334 GTGTGGGGACGGCTGGGGGAAGG - Intronic
1179910652 21:44446056-44446078 CTGTGGGGAAGCCTGGGGATGGG - Intergenic
1180002692 21:45002297-45002319 CTGTGGGGGGAGCTGGGGATGGG + Intergenic
1180089802 21:45528075-45528097 CAGTGGGGACAGTGGAGGCTCGG + Intronic
1180144458 21:45911387-45911409 CTTGGGGGGCAGCTGGGGGTGGG + Intronic
1180412101 22:12623024-12623046 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1180593234 22:16957917-16957939 CTGTGGTGACAGCTGGTCCTGGG - Intergenic
1180643044 22:17314856-17314878 CTCTGCGGACAGTTGGGGTTTGG - Intergenic
1180701407 22:17783326-17783348 CGGTGAGCTCAGCTGGGGCTGGG - Intergenic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181045010 22:20210335-20210357 CTGTGGGGAGAGCCTGGCCTGGG - Intergenic
1181051115 22:20238739-20238761 TGGAGGTGACAGCTGGGGCTGGG - Intergenic
1181185722 22:21102313-21102335 CTGTGGGGAGCTCTGGAGCTGGG + Intergenic
1181634799 22:24169575-24169597 TGGTGGGGACTGCTGGGGGTTGG - Intronic
1182073150 22:27477317-27477339 ATGTGGGGACAGCCTGGGCTAGG - Intergenic
1182107207 22:27698087-27698109 CTGTGTGGACAGCTGGCTCCTGG - Intergenic
1182510131 22:30813751-30813773 GTGTGGGGACAGCTGGTGCTGGG + Intronic
1183099231 22:35573737-35573759 CTGTGTGAACAGAGGGGGCTGGG + Intergenic
1183326768 22:37198775-37198797 CTGCGGGGACTGCGGGGGTTTGG - Intronic
1183326996 22:37199652-37199674 CTGCGGGGACGGCTGGAGCGTGG - Intergenic
1183472200 22:38015656-38015678 CAGAGGGGGCAGCTGAGGCTGGG - Intronic
1183541025 22:38429533-38429555 CTACGGGGACAGCAGGTGCTGGG + Intronic
1183691599 22:39392765-39392787 GTGTGGGGACAGTGGGGGCCAGG - Intergenic
1183778514 22:39983703-39983725 CTGTGGGTACAGATGGTGGTGGG - Intergenic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184234256 22:43174616-43174638 CTGTGGGGAGAGCCCGAGCTGGG + Intronic
1184286048 22:43472057-43472079 CGGTAGGGACAGGTGGGGATTGG + Intronic
1184476062 22:44722055-44722077 TTGGGGGGACTGCTGGGGCGGGG + Intronic
1184486544 22:44783317-44783339 CTGTGTGGACAGCTCGGGGATGG - Intronic
1184694757 22:46133149-46133171 CTGTGGGGGCTGCTGGGGCTGGG + Intergenic
1185052786 22:48562603-48562625 CTGTGGGGACCCCCGGGGCCCGG + Intronic
1185082226 22:48715767-48715789 CAGTGGTGACATCTGTGGCTGGG - Intronic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
1185382268 22:50515185-50515207 GCGTGGGGACAGCTGGGGGTCGG + Intronic
1203292941 22_KI270736v1_random:13283-13305 CTCTGGGAACAACTGTGGCTGGG - Intergenic
949495646 3:4629133-4629155 CTGTGGGGGCAGCAGGGTCCAGG - Intronic
949709825 3:6860986-6861008 CAGTGGGGAGGGCTGGCGCTGGG + Intronic
950055097 3:10017884-10017906 CACTGGGGAAAGCTAGGGCTTGG + Intergenic
950524407 3:13515766-13515788 CACTGGGGACAGCTGGGGGCTGG - Intergenic
950528824 3:13540652-13540674 CTCTGGGTTCAGCTGGGGCAGGG + Intergenic
950789493 3:15461262-15461284 CTGTGGGACCAGATGGTGCTGGG - Intronic
951982078 3:28576378-28576400 CTGAGGCGGCGGCTGGGGCTGGG - Intergenic
952172315 3:30821159-30821181 CTCTGGGGACTGCTGGGTGTGGG + Intronic
952507993 3:34024931-34024953 CTGATGGGTCAGCTGGGGCCTGG + Intergenic
953187808 3:40654608-40654630 CTGTGGGGAGAGCTGGGGAAAGG + Intergenic
953373172 3:42407024-42407046 CTCTGAGGACAGCTGGAGTTGGG + Intronic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
953389364 3:42525712-42525734 CCGTGGGGGCACCTGGGGCAGGG - Intronic
953666133 3:44927840-44927862 CTGGGAGGACAGCTGAGTCTGGG + Intronic
954070835 3:48141718-48141740 CTGTGGGGACAGCTGCTTCATGG + Intergenic
954292727 3:49658240-49658262 CTGTGGGGGCCCCTCGGGCTAGG - Intronic
954299398 3:49691353-49691375 CTCTGGGGCCAGCAGGGGCCAGG + Intronic
954365624 3:50144630-50144652 CTGTGGGGACAGCATGGGTAGGG + Intergenic
954365782 3:50145312-50145334 CTGGTGGGGCAGCTGGGGCAAGG + Intergenic
954384628 3:50237616-50237638 TTGAGGGGCCAGCTGGGGGTGGG + Intronic
954400145 3:50315236-50315258 CTGTGGGGAAAGCGGGGAGTGGG - Intergenic
954407448 3:50353358-50353380 CTGTGTGCACTGCTGGGCCTCGG + Exonic
954424664 3:50437080-50437102 CTCTGGGGCCAGCTGGGCCCAGG + Intronic
954438613 3:50509361-50509383 CAATGGGGACAGCTGAGGCAGGG - Intergenic
954440090 3:50516978-50517000 CTGTGGGGAAAGCTGGGGCTGGG + Intergenic
954636378 3:52073109-52073131 CTGAGGGCAGAGCTGGGGGTGGG - Intergenic
954710620 3:52503554-52503576 CTGTGGGGACAGTTCCGGCCTGG - Intronic
954718308 3:52538256-52538278 CTGGTGGGACACCTGGGGCAGGG + Intronic
954752853 3:52823449-52823471 CAGAGGGGAAAGCTGGAGCTGGG + Intronic
954796334 3:53163004-53163026 CTGTGGAGTGAGCTGGGGCTTGG + Intronic
955059355 3:55482660-55482682 TTTTGGGGACAACTGGGCCTTGG - Intronic
955087743 3:55719824-55719846 CTGGGGGGTCTGCTGGGGCCAGG - Intronic
957083095 3:75655552-75655574 CTGCTGGGCCAGCTCGGGCTGGG + Intergenic
958044826 3:88271001-88271023 CTGTGGGTAGAGCTGAGGGTGGG - Intergenic
958538651 3:95438483-95438505 CTCTGGGGACAGCTTGAGGTGGG - Intergenic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
961167030 3:124770403-124770425 CTGTGGGGACCAAAGGGGCTGGG + Intronic
961193377 3:124981181-124981203 CTGTGGGGACAGATGAGGGGAGG - Intronic
961270451 3:125683802-125683824 CTTGGGGGACAGCCTGGGCTGGG + Intergenic
961456329 3:127026342-127026364 CTTTGGGGTCAGCTGGATCTGGG + Intronic
961487634 3:127227741-127227763 CTGTGGCTGCAGCTGGGGCCAGG + Intergenic
961506163 3:127371887-127371909 CAGAGGAGACAGATGGGGCTGGG + Intergenic
961551211 3:127671618-127671640 GTGTGGGGACAGGTGGGGCTGGG + Intronic
961828960 3:129613484-129613506 CTTTGCTGACAGCAGGGGCTGGG + Intergenic
962412351 3:135152381-135152403 CTGGGGGTACAGCAGGAGCTTGG + Intronic
963906236 3:150775221-150775243 CTGTGAGGCCAGCAGGAGCTGGG - Intergenic
963969727 3:151416331-151416353 CTGGGGAGGCTGCTGGGGCTGGG - Exonic
963969734 3:151416349-151416371 CTGCGAGGACTGCTGGGGCTGGG - Exonic
965564616 3:170100982-170101004 CTATGTGGATACCTGGGGCTGGG - Intronic
965789222 3:172369748-172369770 ATGTGGGGACACCTGAGGCAGGG - Intronic
966897406 3:184456256-184456278 GTGTGGGGACATCTGGCGCCTGG + Intronic
967843862 3:194029314-194029336 CTGTGAGGACACCTGGCTCTGGG + Intergenic
968084269 3:195867534-195867556 CCGTGGGGGCGGCGGGGGCTGGG + Exonic
968486730 4:866535-866557 CTGTGGGGACAGGCGGGCATGGG + Intronic
968567835 4:1323837-1323859 CTGTGGGGACAGGCAGGGCCAGG + Intronic
969172760 4:5377031-5377053 CTGTGGGGAGAGCTGGGGGCAGG - Intronic
969232464 4:5841264-5841286 TTCTGGGGGCAGCTGGGGCCTGG - Intronic
969584645 4:8084777-8084799 GTGTGGGGCCAGCAGGGGCGTGG - Intronic
970450675 4:16164076-16164098 CTTTGGGGACAGCTGGGCTGGGG + Intronic
971298571 4:25423464-25423486 CTGTGGGGACAGGTGCTGGTGGG + Intergenic
971540354 4:27808424-27808446 ATAAAGGGACAGCTGGGGCTGGG - Intergenic
974659706 4:64871454-64871476 CTGTCGGGGTTGCTGGGGCTAGG - Intergenic
975544934 4:75550707-75550729 GTGTGGGGACAGCAGAGACTGGG - Intergenic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
981011383 4:139928707-139928729 ACGTGGGGACAGCTGGGTCCCGG + Intronic
981548496 4:145918707-145918729 CTGGGGTGAGAGCTGGGGGTGGG - Intronic
982871292 4:160582025-160582047 CTCTGGGGACTGCTGTGGGTTGG - Intergenic
982906421 4:161080333-161080355 CTGTGGGGGGAGCAGGGGTTGGG + Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984948170 4:184986231-184986253 CTGTGGGGAGAGCCGTGGCTGGG - Intergenic
985130634 4:186735100-186735122 CTGAAGGTACAGCTAGGGCTGGG - Intergenic
985438501 4:189959462-189959484 CTCTGGAGTCAGCTGGGCCTGGG - Intronic
985767174 5:1786211-1786233 CTGGGGGGTCAGATGGGGCAGGG - Intergenic
985768804 5:1796186-1796208 CACTGTGGACATCTGGGGCTGGG - Intergenic
985779119 5:1860658-1860680 CAGTGGGAACAGCACGGGCTGGG - Intergenic
989623835 5:43410678-43410700 CTGTGGGGACAGGTGGGAGTAGG + Intronic
991039789 5:62163107-62163129 CTATGGAGCCAGCAGGGGCTAGG - Intergenic
996442914 5:123512282-123512304 CGGTGGCGACAGCAGAGGCTCGG + Intronic
997234179 5:132263332-132263354 CGGTGGCGACAGCTGTGGCAGGG - Intronic
997584397 5:135035794-135035816 TTGTGGGGGCTGCTGGGGCCAGG + Intronic
997593724 5:135092165-135092187 CTGTGGTGACGGCTGGGATTGGG + Intronic
997891616 5:137682036-137682058 CTGGGGGTACAGTTGGGTCTCGG + Intronic
998397053 5:141825459-141825481 CAGTGTGGGCACCTGGGGCTTGG + Intergenic
998398654 5:141836023-141836045 CTGGGGGGTGAGCTGGGTCTGGG + Intergenic
999198975 5:149802681-149802703 CAGATGGGGCAGCTGGGGCTGGG + Intronic
999453215 5:151694023-151694045 CAGTGTGGACAGCTAGGCCTGGG + Intergenic
999912982 5:156226091-156226113 CTGGGGGGACAGGTGGTGTTTGG + Intronic
1001148274 5:169203857-169203879 CTGTGGGTAGAGCAGGGGGTTGG + Intronic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1001427211 5:171630470-171630492 CTTTGGGGACAGACGGGACTGGG + Intergenic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1002195114 5:177497159-177497181 CTGTGGAGACAGATGGGGGCTGG + Intronic
1002598880 5:180342501-180342523 CTGTGGGGATAGCTTGGGCCTGG - Intronic
1002858055 6:1055545-1055567 CTGTGGGGGCTGCAGGGGATGGG + Intergenic
1002932455 6:1643997-1644019 GTCTGGGGACAACGGGGGCTGGG - Intronic
1004003131 6:11614140-11614162 CTGTGGGCCCAGCATGGGCTTGG + Intergenic
1005367872 6:25097678-25097700 CTGGGTGGAGAGCTGGGGCTGGG - Intergenic
1005962556 6:30704337-30704359 CTGTGGGGACAACTGGCTCAGGG + Exonic
1005962787 6:30705444-30705466 CTGTGGGGACAACTGGTTCAGGG + Exonic
1005962836 6:30705690-30705712 CTGTGGGGACAACTGGTTCAGGG + Exonic
1005996866 6:30936820-30936842 TGGTGGGGAGAACTGGGGCTTGG + Intergenic
1006094527 6:31647616-31647638 GTGTTGGGCCCGCTGGGGCTGGG + Exonic
1006804556 6:36779695-36779717 GTGTTGGGTCAGCTGGGGCAGGG - Intronic
1006933883 6:37704225-37704247 CAGTGGAGTCAGATGGGGCTGGG - Intergenic
1006987005 6:38182549-38182571 CTGTGGGGAGAGCAGGGCCATGG - Intronic
1007335425 6:41151867-41151889 CTGAGGGCAGAGCTTGGGCTAGG - Intronic
1007740730 6:44008091-44008113 CTGGGGGGTTGGCTGGGGCTGGG + Intergenic
1008661370 6:53671456-53671478 ATGAGGGGAGAGCTGTGGCTGGG + Intergenic
1010150613 6:72727738-72727760 GGGTGGGGTCAGCTGGGGTTTGG + Intronic
1013138333 6:107304872-107304894 CTGTGGGGAAATCCTGGGCTTGG + Intronic
1013888591 6:115000040-115000062 CTGTGGGGAGACCTGGGTATGGG - Intergenic
1014530552 6:122553895-122553917 CTGTCAGGCCAGCTGGAGCTTGG + Intronic
1014791276 6:125675197-125675219 CTATGGGGAGTGCTGGAGCTGGG - Intergenic
1015656495 6:135524805-135524827 CTATGGGGAAGACTGGGGCTGGG + Intergenic
1015669429 6:135672076-135672098 ATGTGCAGACAGCTGGGCCTGGG + Intergenic
1016893603 6:149031993-149032015 GAGTGAGGAGAGCTGGGGCTTGG + Intronic
1018910230 6:168097468-168097490 CTGACGGGACAGGTGGGGCCAGG + Intergenic
1019557799 7:1641281-1641303 GTGTGAGGACAGATGGGGCAGGG - Intergenic
1019563917 7:1670482-1670504 CTGGGGGCGCAGCAGGGGCTGGG - Intergenic
1019578032 7:1746842-1746864 CTGCGGGGACAGCTGCGAGTAGG - Exonic
1019777110 7:2918450-2918472 CTGTGGGGGCAGCAGGGGCAGGG - Intronic
1020431262 7:8118758-8118780 CTCTGGGGACAGGTGGGTCTTGG - Intronic
1020479374 7:8638869-8638891 CTTTGGGGACAGCTAGACCTTGG + Intronic
1020748716 7:12111973-12111995 CTGTGCGCAGAGCTGAGGCTGGG - Intergenic
1020771746 7:12403958-12403980 CTATGGGGACAGGTTGGGCGTGG - Intergenic
1021960786 7:25871137-25871159 CTGTGGGGACATGAGGGCCTGGG + Intergenic
1022112268 7:27239134-27239156 CGGTGGGGACAGCCGGAGGTGGG - Intergenic
1022949907 7:35328248-35328270 CTGTGGGCACAACTGTGCCTTGG - Intergenic
1022953374 7:35359899-35359921 CTGGGGGAACAGGTGGTGCTTGG + Intergenic
1023057550 7:36302216-36302238 TTGTGGGTGGAGCTGGGGCTGGG - Intergenic
1024059588 7:45687830-45687852 CTGTGGAGAGAGCTGTGTCTGGG + Intronic
1024063515 7:45715655-45715677 ATGTGGGGGCAGCAGGGGCCTGG + Exonic
1024191811 7:47019778-47019800 CTGTGGCCAGGGCTGGGGCTGGG - Intergenic
1025502685 7:61324509-61324531 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1025517555 7:61670731-61670753 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1025541878 7:62099381-62099403 CACCGGGGACTGCTGGGGCTGGG + Intergenic
1026018924 7:66693468-66693490 CTCTGGGGGCAGCAGGGTCTTGG - Intronic
1026045506 7:66903418-66903440 CTGAGGCAACAGCTGGGACTGGG - Intergenic
1026584067 7:71642036-71642058 GTGGGGGGACAGCTGATGCTGGG - Intronic
1026963430 7:74424351-74424373 CTTTGGGGGCAGCTGGGGATGGG + Intergenic
1027235777 7:76297043-76297065 TTTTGGGGACAGATAGGGCTGGG - Intergenic
1027494230 7:78867526-78867548 CTCTGGGGACTGCTGTGGCGTGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1029628718 7:101736864-101736886 ATGTGGGGGCAGCTGTGGCCTGG - Intergenic
1029714737 7:102319806-102319828 CTGTGGGAACAGCTGGAACAGGG - Intronic
1030619139 7:111770382-111770404 TTGTGGGGCCATCTGGGGCAAGG - Intronic
1031923569 7:127618645-127618667 CTCTGGGGACAGCTGGTGCTAGG - Intergenic
1032000344 7:128261098-128261120 CTCTGGGGAGAGGTGGGGATGGG - Intergenic
1032991843 7:137402759-137402781 ATGTGGGGAGAGCTGGCACTGGG + Intronic
1033349634 7:140551606-140551628 CTGTGAGGTCAGCTGGGGTTTGG - Intronic
1033658176 7:143387225-143387247 CTCTGGGTACAGATGGGGGTCGG + Intronic
1034224445 7:149471826-149471848 CTATGAGGATAGCTGGGGATGGG - Intergenic
1034338541 7:150338488-150338510 CTGGGAGGAAAGCTGGGACTGGG - Intronic
1034427961 7:151024356-151024378 CGGTGGGGAGATCTGGGGCCCGG - Exonic
1034513882 7:151558524-151558546 CGGGTGGGACAGCTGGGACTTGG + Intronic
1034994508 7:155569704-155569726 CTGTGTGGGCACCAGGGGCTGGG - Intergenic
1035137778 7:156722655-156722677 CTGTTTGGACAGCTGGGTCCAGG + Intronic
1035342033 7:158168804-158168826 AGGTGAGGACAGCTGGGCCTTGG - Intronic
1035458237 7:159023428-159023450 CTGTGGGCACAGCCGGGGGCGGG - Intergenic
1035477032 7:159151111-159151133 CTGTGGCCACAGCTGTGTCTCGG + Intergenic
1035530202 8:345332-345354 CTGTGGGAGCAGCATGGGCTTGG - Intergenic
1035642733 8:1196360-1196382 CTGTGCTGACACCTGGGGATGGG - Intergenic
1035780429 8:2223455-2223477 TTGGGGGGCCAGCTGAGGCTGGG + Intergenic
1036084394 8:5598055-5598077 ATGTGGGCAGAGCTGGTGCTAGG + Intergenic
1037731032 8:21524207-21524229 ATGTGGGGATTGATGGGGCTTGG - Intergenic
1037887482 8:22602454-22602476 CTGTGGCGACAGCTGTCTCTGGG + Intronic
1038369039 8:26969575-26969597 CTGTGGCAGCATCTGGGGCTAGG + Intergenic
1038413010 8:27373032-27373054 CTAAGGGGGCAGCTGTGGCTTGG - Intronic
1038670316 8:29577813-29577835 GTGTGGGCACAGATGGGGGTGGG - Intergenic
1038780993 8:30568432-30568454 ACGTGGGGACAGATGGGCCTGGG - Intronic
1038973092 8:32659710-32659732 CTGGGGAGACAGCTGGAGTTAGG - Intronic
1038984246 8:32791570-32791592 CTGGTGGGATGGCTGGGGCTTGG - Intergenic
1039414890 8:37385501-37385523 TTCTGGGGTTAGCTGGGGCTAGG - Intergenic
1040482733 8:47841428-47841450 TTGTGGGAGCAGCTGGGGTTGGG - Intronic
1041023974 8:53665697-53665719 CTGTGCGCCCTGCTGGGGCTGGG - Intergenic
1041128195 8:54666838-54666860 CTCTGAGAACAGATGGGGCTTGG - Intergenic
1041247370 8:55901601-55901623 CTGTGGGGTCAGGTAGGGCCGGG + Intronic
1041257754 8:55993921-55993943 CCCTGGGGACAGCTGAGCCTTGG + Intronic
1041439249 8:57875889-57875911 TAGTGGGTTCAGCTGGGGCTGGG - Intergenic
1041717375 8:60944363-60944385 TTGGAGGGACAGCTGAGGCTTGG + Intergenic
1042486461 8:69351537-69351559 CTGTGGGGACTGCTGTGGGGTGG - Intergenic
1043148316 8:76682390-76682412 CTGGGGTGAACGCTGGGGCTGGG + Intronic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1047171447 8:122497111-122497133 CTGTGGGGAAGGTTGGGGCTGGG - Intergenic
1047730448 8:127723649-127723671 CTGGGGGTACAGCCGAGGCTGGG - Intergenic
1048282290 8:133114347-133114369 CCCTGGGGACAGCAGGGCCTGGG - Intronic
1048976815 8:139677807-139677829 CTGTGGGGACCTGTTGGGCTGGG - Intronic
1049158046 8:141078866-141078888 CTGTGAGGACGGCTGGAGCTGGG - Intergenic
1049178740 8:141209526-141209548 ATGAGGGGACCGCAGGGGCTGGG - Intronic
1049219487 8:141422433-141422455 CTGTCTGGCCAGCCGGGGCTGGG - Intronic
1049222887 8:141435912-141435934 CCGTGGCGACAGCTGGGCATTGG + Intergenic
1049357272 8:142195136-142195158 CCTTGGGGACAGCTGGGGAGAGG - Intergenic
1049432620 8:142572278-142572300 GTGTGGGGCCAGGAGGGGCTTGG - Intergenic
1049536190 8:143183556-143183578 CTGAGGGCTCACCTGGGGCTCGG + Intergenic
1049579842 8:143406344-143406366 CTGTGGGTAGAGGTGGGGGTGGG - Intergenic
1049729068 8:144166689-144166711 CTGTGAGTACAAGTGGGGCTGGG + Intronic
1049894463 9:100681-100703 CTGTGGGCAGAACTGGGGCGTGG - Intergenic
1049958989 9:720436-720458 GTGTGAGGACAGCTTGAGCTTGG - Intronic
1049963091 9:755093-755115 CTGTGGGGAAGGGTGGAGCTAGG + Intergenic
1050486763 9:6142628-6142650 CTGTGGCCACAGCTAGGACTTGG + Intergenic
1052162377 9:25280730-25280752 CAGAGGGGAGAGCTGGGGATGGG + Intergenic
1052763603 9:32618056-32618078 TTGTGGAGACAGCTGGGGGAGGG + Intergenic
1052824193 9:33163505-33163527 CTGGGGGCTCAGCTGGGGCCTGG - Intronic
1052916204 9:33925950-33925972 CTGTGGGGACAGAGGGGAATAGG - Intronic
1053143678 9:35697682-35697704 CTTTGGGGAGTGCTGGGGTTGGG + Exonic
1053553220 9:39106134-39106156 CTTTTGGGGCAGCTGGGACTAGG - Intronic
1053567845 9:39271605-39271627 CTGTGGGAACAGATGAGGCCTGG + Intronic
1053747520 9:41214798-41214820 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1053817333 9:41926305-41926327 CTTTTGGGGCAGCTGGGACTAGG - Intronic
1053833852 9:42112552-42112574 CTGTGGGAACAGATGAGGCTTGG + Intronic
1054107583 9:61069961-61069983 CTTTTGGGGCAGCTGGGACTAGG - Intergenic
1054129298 9:61347394-61347416 CTGTGGGAACAGATGAGGCCTGG - Intergenic
1054338863 9:63835727-63835749 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054479765 9:65650570-65650592 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1054596700 9:67074858-67074880 CTGTGGGAACAGATGAGGCTTGG - Intergenic
1054613274 9:67261164-67261186 CTTTTGGGGCAGCTGGGACTAGG + Intergenic
1054692707 9:68330727-68330749 CTGTGGGCAGAACTGGGGCGTGG + Intronic
1055324903 9:75119021-75119043 CTTTGGGGACAGCAGGGTCTGGG - Intronic
1055644499 9:78350091-78350113 CTGTGGGGTAAGCTAGGGGTTGG + Intergenic
1056781584 9:89554965-89554987 ATGTGGGGACAGATGGGGTCCGG - Intergenic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057829397 9:98395398-98395420 CTGAGGGGAGAGGTGTGGCTGGG + Intronic
1059423885 9:114208984-114209006 CTGTGGAGTCAGCTGGCCCTGGG + Intronic
1059444203 9:114328116-114328138 CTGTGGGCACAGCAGTGGTTTGG - Intergenic
1059445412 9:114334895-114334917 CTGTGGGCACAGCTGTGGTTTGG - Exonic
1059486012 9:114627233-114627255 CTGTGGGCAGAGCTTGGGATTGG + Intronic
1059726216 9:117010800-117010822 CCATGGGGAGATCTGGGGCTGGG + Intronic
1060052445 9:120386944-120386966 CTGTGGGGACATCTGAGCCCAGG + Intergenic
1060516898 9:124271634-124271656 CTCTGGGGCCAGCCGGGCCTGGG - Intronic
1060543417 9:124446933-124446955 AGGTGGGGACAGGTGGGGGTGGG + Intergenic
1060744780 9:126124120-126124142 CAGTGAGGAGGGCTGGGGCTTGG + Intergenic
1061041382 9:128142753-128142775 CTGTGTAGACAGCTGCAGCTGGG - Intergenic
1061061054 9:128250755-128250777 CTGGGGGCACGGCGGGGGCTCGG - Exonic
1061313095 9:129776887-129776909 CTCTGGGGACAGCATGGTCTAGG + Intergenic
1062033162 9:134371186-134371208 CAGTGGGGGCTGCTGGGGCTTGG + Intronic
1062094941 9:134698275-134698297 CTGTGGGAACAGCTGAGTCATGG + Intronic
1062249608 9:135587630-135587652 CACTGTGGACAGCTGGGGCAGGG - Intergenic
1062334101 9:136057371-136057393 GGGGAGGGACAGCTGGGGCTGGG + Intronic
1062566444 9:137165920-137165942 CTGGGTGGACGGCTGGGGCCTGG + Intronic
1062635364 9:137487768-137487790 CTCGGGGGCCAGCTGGGGTTGGG - Intronic
1202783652 9_KI270718v1_random:25569-25591 CTCTGGAGTCAGCTGGGCCTGGG - Intergenic
1202803423 9_KI270720v1_random:23998-24020 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1203448222 Un_GL000219v1:81221-81243 CTCTGGAGTCAGCTGGGCCTGGG + Intergenic
1186225698 X:7396609-7396631 CTGTGAGGACATCTAGGGCTGGG + Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1187049983 X:15686305-15686327 CTGTGGGGAGAGGTGGTCCTTGG - Intergenic
1187979900 X:24745141-24745163 CTTTGGGGACAGCTGGGGAAAGG + Intronic
1188363719 X:29288316-29288338 CACTGGGGCCTGCTGGGGCTGGG - Intronic
1189293107 X:39899903-39899925 CTGTGGGGAAAGCAGGGGACTGG - Intergenic
1189343160 X:40219906-40219928 CAGTGGTCACAGCTGAGGCTAGG - Intergenic
1189848598 X:45158008-45158030 CTGGGGGGCCAGGTGGGGCGTGG + Intronic
1190108325 X:47574180-47574202 GTGTGGGGCCGGCTGGGCCTGGG + Exonic
1191134812 X:57052305-57052327 CTGTGGGGACTGTTGTGGCATGG - Intergenic
1192362255 X:70447241-70447263 CTCTGGGTACCACTGGGGCTGGG + Intronic
1193621398 X:83756473-83756495 CTCTGGGGACTGTTGGGGGTTGG + Intergenic
1196759657 X:119190011-119190033 CGGTGATGACAGCTGGGGGTGGG + Intergenic
1197796086 X:130299772-130299794 CTGCGGGGACACAGGGGGCTAGG + Intergenic
1197961536 X:132011597-132011619 CTGTGGGGACTGCTGTGGGGTGG + Intergenic
1199649867 X:149940038-149940060 CTGTGGGAGCAGATGGGGCGGGG + Intergenic
1199856918 X:151766843-151766865 CTGTGGTGAGAGGTGAGGCTGGG + Intergenic
1200018259 X:153181425-153181447 CTGGGGTGACAGCAGGGGCAGGG - Intronic
1200133357 X:153863185-153863207 CTGTGTGGAGAGGAGGGGCTGGG + Intronic
1200133800 X:153864995-153865017 CTGTGGGGACAGACAGGGGTTGG + Intronic
1201329671 Y:12804029-12804051 CTGGTGGGCCAGCTCGGGCTTGG + Intronic
1202025600 Y:20519606-20519628 CATTGGGGAAAGCTGGGGCTAGG - Intergenic