ID: 1144035675

View in Genome Browser
Species Human (GRCh38)
Location 17:11363354-11363376
Sequence CATTAACCAGACTTGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1518
Summary {0: 1, 1: 0, 2: 1, 3: 73, 4: 1443}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144035675 Original CRISPR CATTAACCAGACTTGGAGGT AGG Intronic
900288333 1:1912772-1912794 AATTAGCCGGACTTGGTGGTGGG + Intergenic
900525562 1:3126712-3126734 CAGGAACCAGTCCTGGAGGTGGG + Intronic
900845719 1:5098616-5098638 AATTAACCAGGCGTGGTGGTGGG + Intergenic
900867615 1:5279685-5279707 AATTAGCCAGGCTTGGAGGCGGG - Intergenic
900989095 1:6089844-6089866 AATTAACCAGATGTGGTGGTGGG - Intronic
901091878 1:6647228-6647250 TATTAACCGGACATGGTGGTGGG - Intronic
901179029 1:7327255-7327277 AATTAGCCAGGCTTGGTGGTGGG + Intronic
901592602 1:10357858-10357880 AATTAGCCAGACTTGGTGGTGGG + Intronic
901667090 1:10832218-10832240 AATTAGCCAGACGTGGTGGTGGG - Intergenic
901844316 1:11972398-11972420 AATTAGCCAGACATGGTGGTGGG - Intronic
902026266 1:13386320-13386342 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
902031687 1:13427594-13427616 AATTAGCCAGGCATGGAGGTGGG + Intergenic
902303418 1:15519326-15519348 CATTAGCCAGGCATGGTGGTGGG - Intronic
902597229 1:17517807-17517829 AATTAGCCAAGCTTGGAGGTGGG - Intergenic
902698668 1:18156973-18156995 CATTAGCCAGGCATGGTGGTAGG + Intronic
902908056 1:19573763-19573785 AATTAGCCAGACATGGTGGTTGG + Intergenic
902942726 1:19812301-19812323 AATTAACCAGGCATGGTGGTGGG - Intergenic
903052693 1:20613351-20613373 AATTACCCAGGCTTGGTGGTGGG - Intronic
903304858 1:22406268-22406290 TATCCACCACACTTGGAGGTGGG + Intergenic
903394959 1:22993613-22993635 AATTAGCCAGACGTGGTGGTGGG - Intergenic
904048800 1:27625788-27625810 AATTAGCCAGACGTGGAGGTGGG + Intronic
904169970 1:28584782-28584804 AATTAACCAGACATGGTGGCGGG + Intergenic
904175622 1:28626430-28626452 AATTAGCCAGACTTGGTGGCAGG + Intronic
904179168 1:28653715-28653737 AATTAGCCAGACGTGGTGGTGGG - Intergenic
904221039 1:28969231-28969253 AATTAACCAGGCATGGTGGTGGG - Intronic
904782328 1:32959900-32959922 AATTAACCAGGCGTGGTGGTGGG + Intronic
904790447 1:33016358-33016380 AATTAGCCAGGCTTGGTGGTGGG - Intronic
905057299 1:35106998-35107020 AATTAGCCAGACGTGGTGGTGGG - Intronic
905228862 1:36499330-36499352 AATTAGCCAGACATGGTGGTGGG - Intergenic
905372817 1:37494364-37494386 CATTGGCCAGACATGGTGGTGGG + Intronic
905406034 1:37733039-37733061 AATTAGCCAGACATGGTGGTGGG - Intronic
905495517 1:38382372-38382394 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
905616233 1:39402061-39402083 AATTAGCCAGGCTTGGTGGTGGG + Intronic
905721141 1:40203392-40203414 CATTAGCCAGGCATGGTGGTGGG + Intronic
905771833 1:40643278-40643300 CATTAGCCAGGCTTGGTGGCGGG - Intronic
905831763 1:41075009-41075031 AATTAACCAGGCGTGGTGGTGGG - Intronic
906504164 1:46365486-46365508 AATTAACCAGGCATGGTGGTGGG - Intergenic
906875842 1:49537776-49537798 CATTAGCCAGGCATGGTGGTGGG + Intronic
907066882 1:51493210-51493232 AATTAGCCAGACGTGGTGGTGGG + Intronic
907428085 1:54393906-54393928 AATTAGCCAGACGTGGTGGTGGG - Intronic
907607319 1:55830837-55830859 GATTTCCCAGATTTGGAGGTTGG - Intergenic
907806760 1:57828092-57828114 CATTAGCCAGGCATGGTGGTGGG - Intronic
907818304 1:57941684-57941706 AATTAGCCAGGCTTGGTGGTGGG + Intronic
908185468 1:61648766-61648788 CATGAACCAGACTTGAAGGAAGG + Intergenic
908280160 1:62525152-62525174 AATTAGCCAGACATGGTGGTGGG - Intronic
908531662 1:65040064-65040086 AATTAGCCAGACATGGTGGTGGG + Intergenic
908641456 1:66228473-66228495 AATTAGCCAGACATGGTGGTGGG + Intronic
908692857 1:66802295-66802317 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
908952860 1:69582821-69582843 CATTAAACAGACTTGCATGCTGG - Intronic
908962278 1:69712453-69712475 AATTAGCCAGGCTTGGTGGTGGG + Intronic
909888224 1:80969690-80969712 AATTAACCAGGCATGGTGGTGGG - Intergenic
910416236 1:87002059-87002081 CATTAGCCAGGCTTGGTGGCGGG - Intronic
910580927 1:88823553-88823575 AATTAGCCAGGCTTGGTGGTGGG + Intronic
910871018 1:91833145-91833167 AATTAACCAGTCTTGGTGGCGGG + Intronic
910889410 1:92001545-92001567 AATTAACCAGGCATGGTGGTGGG + Intronic
911158472 1:94658980-94659002 AATTAGCCAGACATGGTGGTGGG + Intergenic
911317432 1:96371787-96371809 AATTAACCAGGCGTGGTGGTGGG + Intergenic
911390524 1:97235473-97235495 CATTAACCAGGCGTGGTGGCAGG + Intronic
911652609 1:100406775-100406797 AATTAGCCAGGCTTGGTGGTGGG + Intronic
911756340 1:101561054-101561076 AATTAGCCAGACGTGGTGGTGGG - Intergenic
912035767 1:105310773-105310795 AATTAACCAGGCTTGGTGGCAGG - Intergenic
912170666 1:107095477-107095499 CATTAGCCAGACGTGGTGGTGGG + Intergenic
912316743 1:108674318-108674340 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
912367665 1:109148285-109148307 AATTAACCAGGCGTGGTGGTGGG - Intronic
912693222 1:111820202-111820224 CATAAACAAGCCTTGGAGGCAGG - Intronic
912896581 1:113598061-113598083 AATTAGCCAGACATGGTGGTGGG + Intronic
912964035 1:114221551-114221573 AATTAGCCAGACCTGGTGGTGGG + Intergenic
912981703 1:114379807-114379829 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
913264120 1:117027785-117027807 CATTAAAATGAATTGGAGGTCGG + Intronic
913395753 1:118369964-118369986 AATTAGCCAGACGTGGTGGTGGG + Intergenic
914223251 1:145699087-145699109 AATTAGCCAGGCTTGGTGGTGGG + Intronic
914341116 1:146761442-146761464 AATTAACCAGATATGGTGGTGGG + Intergenic
914716851 1:150260906-150260928 AATTAGCCAGACGTGGTGGTGGG - Intronic
914726054 1:150328699-150328721 AATTAGCCAGGCTTGGTGGTGGG - Intronic
914793727 1:150902256-150902278 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
915160535 1:153916954-153916976 AATTAGCCAGACATGGTGGTGGG - Intronic
915181030 1:154060088-154060110 AATTAGCCAGACATGGTGGTGGG + Intronic
915194817 1:154181770-154181792 AATTAGCCAGACTTGGTGGCGGG + Intronic
915199101 1:154213156-154213178 AATTAACCAGGCATGGTGGTAGG + Intronic
915337851 1:155157711-155157733 AATTAGCCAGACATGGTGGTGGG - Intergenic
915397325 1:155595324-155595346 AATTAACCAGGCATGGTGGTGGG - Intergenic
915672666 1:157503525-157503547 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
915793570 1:158702419-158702441 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
915975925 1:160388965-160388987 AATTAACCAGGCATGGTGGTGGG - Intergenic
916349805 1:163836426-163836448 CAAACACCAGGCTTGGAGGTGGG - Intergenic
916430206 1:164720714-164720736 CATTAGCTAGACCTGGAGGCAGG - Intronic
916654402 1:166860816-166860838 AATTAGCCAGGCTTGGTGGTGGG - Intronic
916767003 1:167870658-167870680 AATTAGCCAGACTTGGTGGCGGG + Intronic
917009575 1:170456181-170456203 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
917110535 1:171542907-171542929 AATTAACCAGGCATGGTGGTGGG - Intronic
917312513 1:173691635-173691657 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
917330963 1:173879800-173879822 CATTAGCCAGGCATGGTGGTGGG + Intronic
917343319 1:174003236-174003258 AATTAGCCAGACATGGTGGTGGG + Intronic
917382535 1:174429588-174429610 AATTAGCCAGACATGGTGGTGGG + Intronic
917407453 1:174722596-174722618 AATTAGCCAGACGTGGTGGTGGG - Intronic
918028683 1:180780617-180780639 AATTAGCCAGGCTTGGTGGTGGG + Intronic
918116540 1:181502845-181502867 AATTAGCCAGACATGGTGGTGGG - Intronic
918251564 1:182707853-182707875 AATTAGCCAGACATGGTGGTGGG - Intergenic
918806126 1:189048075-189048097 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
918916748 1:190650612-190650634 CATTAGCCAGGCATGGTGGTGGG - Intergenic
919193090 1:194248539-194248561 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
919417247 1:197326480-197326502 AATTAACCAGGCATGGTGGTGGG + Intronic
919596880 1:199575333-199575355 CATCAACCACAATTGTAGGTTGG - Intergenic
919624972 1:199902475-199902497 AATTAACCAGACATGGTGGTGGG + Intergenic
919870124 1:201813906-201813928 AATTAGCCAGACGTGGTGGTGGG + Intronic
919884095 1:201920206-201920228 AATTAACCAGGCGTGGTGGTGGG - Intronic
920160273 1:203992276-203992298 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
921050884 1:211510693-211510715 AATTAGCCAGACATGGTGGTGGG - Intergenic
921612298 1:217226831-217226853 AATTAGCCAGACGTGGTGGTGGG + Intergenic
921697710 1:218231286-218231308 AATTAACCAGGCGTGGTGGTGGG - Intergenic
921866075 1:220088950-220088972 AATTAGCCAGGCTTGGTGGTGGG + Intronic
922155131 1:223035088-223035110 CATTAACCGGGCTTGGTGGTGGG + Intergenic
922283753 1:224150173-224150195 AATTAGCCAGGCTTGGTGGTGGG + Intronic
922669360 1:227497186-227497208 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
922670232 1:227504116-227504138 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
922731598 1:227951263-227951285 CATTAGACAGGCTTGGTGGTGGG + Intergenic
922994708 1:229946284-229946306 AATTAGCCAGGCATGGAGGTGGG + Intergenic
923057748 1:230440299-230440321 GATTAGCCAGGCATGGAGGTGGG - Intergenic
923154699 1:231268152-231268174 AATTAACCAGGCGTGGTGGTAGG + Intronic
923240113 1:232076221-232076243 AATTATCCAGGCTTGGAGGTGGG - Intergenic
923316207 1:232782919-232782941 AATTAGCCAGACGTGGTGGTGGG - Intergenic
923494401 1:234511883-234511905 AATTAACCAGGCATGGTGGTGGG - Intergenic
923565441 1:235072837-235072859 CATTAGCCAGGCATGGTGGTGGG + Intergenic
923579689 1:235196702-235196724 AATTAGCCAGACGTGGTGGTGGG + Intronic
923665819 1:235997753-235997775 AATTAGCCAGACATGGTGGTGGG - Intronic
923719011 1:236451569-236451591 CATTAGCCAGACATGGTGGTGGG - Intronic
923806618 1:237264842-237264864 AATTAACCAGGCATGGTGGTGGG - Intronic
923966051 1:239140400-239140422 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
924134907 1:240955401-240955423 AATTAGCCAGACATGGTGGTGGG + Intronic
924335473 1:242982972-242982994 AATTATCCAGACATGGTGGTGGG - Intergenic
924485023 1:244474178-244474200 AATTAGCCAGGCTTGGTGGTGGG - Intronic
924515131 1:244759776-244759798 AATTAACCAGGACTGGAGGTGGG + Intergenic
924616254 1:245614321-245614343 AATTAGCCAGACATGGTGGTGGG - Intronic
924797956 1:247306343-247306365 AATTAACCAGGCGTGGTGGTGGG - Intronic
1062896419 10:1106663-1106685 AATTAACCAGGCATGGTGGTGGG - Intronic
1062936179 10:1391912-1391934 AATTAACCAGGCATGGTGGTGGG - Intronic
1063014360 10:2060612-2060634 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1063038553 10:2314167-2314189 AATTAGCCAGATTTGGTGGTAGG + Intergenic
1063075895 10:2716184-2716206 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1063232555 10:4079826-4079848 AATTAACCAGGCATGGTGGTGGG - Intergenic
1063471973 10:6295368-6295390 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
1064067068 10:12191233-12191255 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1064095918 10:12424394-12424416 CACCAATCAGACTTGGAGGAGGG - Intronic
1064309473 10:14199536-14199558 AATTAGCCAGACGTGGTGGTGGG - Intronic
1064666193 10:17654369-17654391 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1064697753 10:17985192-17985214 AATTAGCCAGACATGGTGGTGGG + Intronic
1065061708 10:21909033-21909055 AATTAGCCAGACGTGGTGGTGGG - Intronic
1065253278 10:23838607-23838629 AATTAGCCAGGCATGGAGGTGGG - Intronic
1065328151 10:24568643-24568665 AATTAGCCAGACATGGCGGTGGG + Intergenic
1065346773 10:24756008-24756030 AATTAGCCAGGCATGGAGGTGGG + Intergenic
1065928761 10:30459989-30460011 AATTAGCCAGACGTGGTGGTGGG - Intronic
1066120448 10:32281181-32281203 AATTAGCCAGACGTGGTGGTGGG - Intronic
1066226395 10:33387538-33387560 CATTAGCCAGGCTTGGTGGTGGG - Intergenic
1066295904 10:34054358-34054380 AATTAGCCAGCCTTGGTGGTGGG + Intergenic
1066303289 10:34115859-34115881 CATTAGCCAGGCTTGGTGGTGGG - Intronic
1066379994 10:34893043-34893065 AATTAGCCAGACATGGTGGTAGG - Intergenic
1066417362 10:35233541-35233563 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1066497324 10:35954978-35955000 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1066632272 10:37469032-37469054 AATTAACCAGGCATGGTGGTGGG - Intergenic
1066669099 10:37818062-37818084 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1067017822 10:42771007-42771029 AATTAACCAGACGTGGTGGCAGG + Intergenic
1067092574 10:43276264-43276286 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1067260966 10:44691069-44691091 AATTAGCCAGACCTGGTGGTGGG - Intergenic
1067373901 10:45709904-45709926 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
1067384739 10:45808353-45808375 CATTAGCCAGGCGTGGTGGTAGG + Intergenic
1067391475 10:45866853-45866875 AATTAGCCAGTCTTGGTGGTGGG - Intergenic
1067713313 10:48667651-48667673 AATTAACCAGGCGGGGAGGTGGG + Intergenic
1067727818 10:48785004-48785026 CATTAGCCAGGCATGGTGGTGGG - Intronic
1067871814 10:49969286-49969308 AATTAGCCAGTCTTGGTGGTGGG + Intronic
1068247317 10:54389801-54389823 AATTAACCAGGCATGGTGGTGGG + Intronic
1068353839 10:55884416-55884438 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1068421542 10:56801066-56801088 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1068725807 10:60301559-60301581 AATTAGCCAGACATGGTGGTGGG - Intronic
1069488444 10:68841093-68841115 AATGAGCCAGACTTGGTGGTAGG - Intronic
1069535707 10:69251241-69251263 AATTAGCCAGGCGTGGAGGTAGG - Intronic
1069542021 10:69302096-69302118 AATTAGCCAGGCGTGGAGGTAGG + Intronic
1069743922 10:70702918-70702940 CAGTAGACAGACTTGAAGGTAGG - Intronic
1069850435 10:71400648-71400670 AATTACCCAGACGTGGTGGTGGG + Intronic
1071340227 10:84639491-84639513 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1071599048 10:86947516-86947538 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1072059156 10:91792135-91792157 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1072110881 10:92318853-92318875 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1072323227 10:94271461-94271483 AATTAGCCAGACGTGGTGGTGGG - Intronic
1072469675 10:95700939-95700961 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1072513254 10:96150183-96150205 AATTAACCAGGCGTGGTGGTGGG + Intronic
1072579906 10:96731728-96731750 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1072635910 10:97177825-97177847 AATTAGCCAGACATGGTGGTAGG + Intronic
1072908862 10:99482111-99482133 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1073003990 10:100307509-100307531 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1073696885 10:105879574-105879596 AATTAAAAAGTCTTGGAGGTGGG - Intergenic
1073951541 10:108814804-108814826 AATTAGCCAGACATGGTGGTGGG + Intergenic
1074523762 10:114247444-114247466 AATTAGCCAGACATGGTGGTGGG - Intronic
1074551122 10:114443459-114443481 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1074705734 10:116128575-116128597 CATTAGCCAGGCTTGGTGGCGGG + Intronic
1074824643 10:117205899-117205921 AATTAACCAGGCATGGTGGTGGG + Intronic
1074864834 10:117538668-117538690 CAGTAACAAGCCTTGGAGGTGGG + Intergenic
1075220439 10:120579969-120579991 AATTAGCCAGACTTGGTGATGGG + Intronic
1075358142 10:121802455-121802477 AATTAGCCAGACGTGGTGGTGGG - Intronic
1075378678 10:122000228-122000250 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1075681596 10:124337321-124337343 AATTAGCCAGACATGGTGGTGGG + Intergenic
1077132793 11:982197-982219 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1077345152 11:2044589-2044611 AATTAACCAGGCTTGGTGGTGGG - Intergenic
1077596946 11:3541131-3541153 AATTAACCAGGCATGGTGGTAGG + Intergenic
1077810876 11:5635401-5635423 AATTAGCCAGACGTGGTGGTGGG - Intronic
1078543062 11:12226799-12226821 AATTAGCCAGACGTGGTGGTAGG - Intronic
1078557491 11:12341901-12341923 GATTTACCAGCCTTGGTGGTTGG + Intronic
1078814683 11:14807909-14807931 AATTAACCAGACGTGGTGGTGGG + Intronic
1079477083 11:20842226-20842248 AATTAACCAGGCATGGTGGTGGG + Intronic
1079953424 11:26832936-26832958 CACTAGCCGGACTTGGTGGTGGG + Intergenic
1081015658 11:37876429-37876451 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1081156462 11:39698701-39698723 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1081186659 11:40051229-40051251 AATTAACCAGACGTGGTGGCAGG + Intergenic
1082072168 11:47947907-47947929 AATTAGCCAGACTTGGTGTTGGG + Intergenic
1082177056 11:49072879-49072901 AATTATCCAGACATGGTGGTGGG + Intergenic
1082201902 11:49382077-49382099 AATTAGCCAGACATGGTGGTGGG + Intergenic
1082208335 11:49466691-49466713 CATTTTCAAGACTTGGTGGTGGG + Intergenic
1082726969 11:56747821-56747843 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1082850112 11:57756824-57756846 AATTAGCCAGACATGGTGGTGGG + Intronic
1082952031 11:58827716-58827738 AATTAACCAGGCTTGGTGGCAGG - Intergenic
1083022007 11:59516918-59516940 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1083038039 11:59658469-59658491 AATTAACCAGGCGTGGTGGTGGG - Intronic
1083075778 11:60035715-60035737 AATTAGCCAGACATGGTGGTGGG + Intergenic
1083225005 11:61279424-61279446 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1083348260 11:62009308-62009330 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1083468363 11:62864613-62864635 AATTAGCCAGACTTGGTGGTGGG - Intronic
1083478808 11:62930458-62930480 CTTGAACCAGGCTTGGGGGTTGG - Intergenic
1083481482 11:62950491-62950513 AATTAGCCAGACATGGTGGTGGG + Intronic
1083576322 11:63794450-63794472 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1083783192 11:64928626-64928648 CATTAGCCAGGCATGGTGGTGGG + Intronic
1083818827 11:65154417-65154439 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1083851394 11:65369579-65369601 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1083858741 11:65407746-65407768 AATTAGCCAGACGTGGTGGTGGG + Intronic
1083954043 11:65973023-65973045 AATTAACCAGACGTGGTGGCGGG + Intronic
1084442716 11:69184344-69184366 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1084530490 11:69724728-69724750 AATTAGCCAGACATGGTGGTGGG - Intergenic
1084578485 11:70006816-70006838 AATTAGCCAGACTTGGTGGTAGG - Intergenic
1084819996 11:71680939-71680961 AATTAACCAGGCATGGTGGTAGG - Intergenic
1085101790 11:73807016-73807038 AATTAGCCAGACATGGTGGTGGG - Intronic
1085236281 11:75017862-75017884 CAGTGACAAGACTGGGAGGTAGG + Intronic
1085628206 11:78089903-78089925 AATTAACCAGGCATGGTGGTAGG - Intergenic
1085652166 11:78278216-78278238 AATTAACCAGGCATGGTGGTGGG - Intronic
1085654583 11:78301476-78301498 CATTAGCCAGGCTTGATGGTGGG - Intronic
1085868807 11:80326158-80326180 AATTAGCCAGGCTTGGTGGTAGG + Intergenic
1086169859 11:83823891-83823913 CATTAACTAGACTTTGAGTATGG + Intronic
1086593233 11:88540893-88540915 AATTAACCAGGCGTGGTGGTGGG - Intronic
1086653764 11:89324079-89324101 AATTAGCCAGACATGGTGGTGGG - Intergenic
1086795792 11:91100381-91100403 TATTAACCAAACTATGAGGTGGG - Intergenic
1087088875 11:94247651-94247673 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1087133193 11:94687051-94687073 AATTAGCCAGACATGGAGGCGGG + Intergenic
1087224105 11:95578796-95578818 AATTAACCAGACATGGTGGCAGG + Intergenic
1087566168 11:99861102-99861124 AATTAGCCAGGCTTGGTGGTTGG - Intronic
1087670239 11:101097923-101097945 AATTAGCCAGACGTGGTGGTGGG - Intronic
1088054596 11:105559541-105559563 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1088454645 11:110020987-110021009 AATTAGCCAGACATGGTGGTGGG - Intergenic
1088459421 11:110066978-110067000 AATTAGCCAGACATGGTGGTAGG + Intergenic
1088523855 11:110730105-110730127 AATTAGCCAGTCTTGGTGGTGGG + Intergenic
1088835614 11:113575917-113575939 AATTAACCAGGCATGGTGGTGGG - Intergenic
1088863515 11:113824464-113824486 AATTAATCAGACTTGGTGATGGG - Intronic
1089261210 11:117225208-117225230 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1089497486 11:118914985-118915007 AATTATCCAGACATGGTGGTGGG + Intronic
1089529128 11:119115104-119115126 CATTAGCCAGACGTGGTGGCAGG + Intronic
1089543144 11:119203111-119203133 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1089546240 11:119228254-119228276 CATTAAGTAGACATGGTGGTGGG - Intronic
1089751786 11:120656703-120656725 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1089974182 11:122718068-122718090 AATTAGCCAGACTTGGTAGTGGG - Intronic
1090045821 11:123332305-123332327 AATTAACCAGACGTGGTGGTGGG - Intergenic
1091441560 12:514878-514900 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1091476829 12:783352-783374 CAATAACCATACTTGGGGCTGGG + Intronic
1091692604 12:2607193-2607215 CATTAACAAAACTTGGGGATGGG - Intronic
1091934205 12:4422567-4422589 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1092378702 12:7977300-7977322 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1092457022 12:8653041-8653063 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1092604616 12:10104606-10104628 AATTAGCCAGACATGGTGGTGGG + Intronic
1092778049 12:11961218-11961240 AATTAACCGGGCTTGGAGGCAGG + Intergenic
1093026845 12:14253271-14253293 AATTAGCCAGGCTTGGTGGTAGG + Intergenic
1093210339 12:16300666-16300688 AATTAGCCAGACATGGTGGTGGG - Intergenic
1093478293 12:19579124-19579146 AATTAGCTAGACTTGGTGGTGGG + Intronic
1093500848 12:19810238-19810260 GCTCAACCAGAGTTGGAGGTTGG + Intergenic
1093508548 12:19898701-19898723 TATTAACTAGCTTTGGAGGTGGG + Intergenic
1093663237 12:21781803-21781825 AATTAGCCAGACTTGGTGGCAGG - Intergenic
1093878019 12:24372820-24372842 CTTTAAACAGACTTGGGGATGGG + Intergenic
1094177784 12:27559315-27559337 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1094193099 12:27716840-27716862 AATTAGCCAGACGTGGTGGTGGG + Intronic
1094431793 12:30378181-30378203 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1094704878 12:32904650-32904672 AATTAACCAGACATGGTGGCAGG - Intergenic
1094823195 12:34243554-34243576 AATTAGCCAGACATGGTGGTGGG + Intergenic
1095113412 12:38324179-38324201 AATTAGCCAGGCTTGGTGGTGGG - Exonic
1095213716 12:39524341-39524363 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1095253684 12:40008460-40008482 CATTAGCCAGACATGGTGGTGGG + Intronic
1095588992 12:43882309-43882331 CATTAGCCAGGCTTGGTGGCAGG + Intronic
1095764258 12:45876941-45876963 AATTAACCAGGCCTGGTGGTGGG + Intronic
1096015906 12:48274579-48274601 AATTAGCCAGACATGGTGGTGGG + Intergenic
1096026248 12:48365535-48365557 CATTAGCCAGGCGTGGTGGTCGG - Intergenic
1096201086 12:49683655-49683677 AAGGAACCAGAATTGGAGGTAGG - Intronic
1096289857 12:50332877-50332899 AATTAACCAGACATGGTGGCAGG + Intronic
1096301733 12:50434552-50434574 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1096364199 12:51014702-51014724 CATTAGCCAGGCGTGGTGGTAGG + Intronic
1096438420 12:51616461-51616483 AATTAGCCAGACATGGTGGTGGG + Intronic
1096729395 12:53595643-53595665 CAATAAACAGCTTTGGAGGTTGG + Intronic
1097003691 12:55900129-55900151 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1097087077 12:56476741-56476763 AATTAGCCAGGCTTGGTGGTGGG - Exonic
1097115142 12:56691475-56691497 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1097229292 12:57499453-57499475 AATTAACCAGGCGTGGTGGTGGG + Intronic
1097300413 12:58012664-58012686 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1097568629 12:61302807-61302829 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1097814072 12:64052404-64052426 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1097826087 12:64176029-64176051 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1097947560 12:65388720-65388742 AATTAGCCAGACATGGTGGTGGG + Intronic
1097988092 12:65805529-65805551 AATTAGCCAGACATGGTGGTGGG + Intergenic
1098196561 12:68008265-68008287 AATTAACCAGGCATGGTGGTGGG + Intergenic
1098251062 12:68570016-68570038 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1098254853 12:68606437-68606459 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1098277730 12:68830665-68830687 TTTTAACCAAACTTGTAGGTTGG - Intronic
1098379604 12:69853852-69853874 CATTTCCCAGACTGGGCGGTGGG + Intronic
1098848749 12:75569375-75569397 AATTAACCAGGCATGGTGGTGGG + Intergenic
1098941447 12:76541704-76541726 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1099121313 12:78692557-78692579 AATTAACCAGACATGGTTGTGGG - Intergenic
1099722885 12:86386077-86386099 AATTAGCCAGACGTGGTGGTGGG - Intronic
1100285560 12:93162945-93162967 AATTAACCAGGCATGGTGGTGGG + Intergenic
1100318870 12:93471310-93471332 TATTAACCAGGCCTGGTGGTAGG - Intronic
1100350746 12:93779736-93779758 AATTAGCCAGACATGGTGGTGGG - Intronic
1100374022 12:93995454-93995476 AATTAACCAGGCATGGTGGTGGG + Intergenic
1100376525 12:94021202-94021224 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1100399391 12:94215043-94215065 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1100541364 12:95560657-95560679 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1100546425 12:95607053-95607075 GTTTAACCAGAATTGCAGGTTGG - Intergenic
1100675268 12:96859552-96859574 AATTAACCAGGCATGGTGGTGGG - Intronic
1100705858 12:97199319-97199341 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1100801097 12:98231496-98231518 CATTAGCCAGGCTTGGTGGCGGG + Intergenic
1100859078 12:98785319-98785341 AATTAACCAGGCATGGTGGTGGG + Intronic
1101041074 12:100756496-100756518 AATTAGCCAGACGTGGTGGTGGG - Intronic
1101388442 12:104278347-104278369 AATTAGCCAGGCTTGGGGGTGGG - Intronic
1101636092 12:106542679-106542701 CAATCACCAGTGTTGGAGGTGGG - Intronic
1101684910 12:107009388-107009410 AATTAGCCAGACGTGGTGGTGGG + Intronic
1101752070 12:107590056-107590078 AATTAACCAGGCATGGTGGTGGG - Intronic
1102033686 12:109759142-109759164 CAGTCAGGAGACTTGGAGGTGGG - Intronic
1102083914 12:110120603-110120625 AATTAGCCAGACATGGTGGTGGG - Intergenic
1102273990 12:111565845-111565867 AATTAGCCAGACGTGGTGGTGGG + Intronic
1103018344 12:117513605-117513627 AATGAACCTGATTTGGAGGTAGG + Intronic
1103066865 12:117906202-117906224 AATTAACCAGGCATGGTGGTGGG + Intronic
1103121418 12:118382814-118382836 AATTAGCCAGACGTGGTGGTGGG - Intronic
1103358408 12:120339108-120339130 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1103383304 12:120512059-120512081 AATTAGCCAGACGTGGTGGTGGG + Intronic
1103395466 12:120603601-120603623 AATTAGCCAGGCTTGGTGGTAGG - Intergenic
1103616876 12:122159338-122159360 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
1103804516 12:123561961-123561983 AATTAGCCAGACATGGTGGTGGG + Intergenic
1104207065 12:126649360-126649382 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1104259756 12:127171863-127171885 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1104787940 12:131461813-131461835 AATTAACCAGGCATGGTGGTGGG + Intergenic
1105298487 13:19112080-19112102 AATTAGCCAGACATGGTGGTGGG + Intergenic
1105300080 13:19125384-19125406 AATTAGCCAGACATGGTGGTGGG - Intergenic
1105390994 13:19978023-19978045 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1105496384 13:20934414-20934436 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1105508537 13:21032413-21032435 AATTAGCCAGACGTGGTGGTGGG - Intronic
1105558551 13:21468710-21468732 AATTAGCCGGGCTTGGAGGTGGG - Intergenic
1105686080 13:22783412-22783434 GATTAGCCAGGCTTGGTGGTGGG - Intergenic
1105810141 13:23988090-23988112 AATTAACCAGACGTGGTGGTAGG - Intronic
1105883012 13:24620088-24620110 AATTAACCAGGCATGGTGGTGGG - Intergenic
1105935553 13:25095259-25095281 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1106272651 13:28169376-28169398 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1106385094 13:29276747-29276769 CATTAGCCAGCCATGGTGGTGGG + Intronic
1106549175 13:30756662-30756684 CATTAGCCAGGCATGGTGGTGGG + Intronic
1106717590 13:32407268-32407290 CATTTCCCAGGCGTGGAGGTTGG + Exonic
1106732124 13:32552283-32552305 AATTAGCCAGACATGGTGGTGGG - Intergenic
1106755514 13:32819412-32819434 AATTAGCCAGACATGGTGGTTGG - Intergenic
1106807147 13:33321355-33321377 AATTAGCCAGACATGGTGGTAGG + Intronic
1106814242 13:33389102-33389124 AATTAGCCAGACGTGGTGGTTGG - Intergenic
1107024293 13:35783880-35783902 AATTAAACAGTCTTGGAGGCTGG - Intronic
1107090754 13:36476582-36476604 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1107126673 13:36854008-36854030 AATTAACCAGGCATGGTGGTGGG + Intronic
1107201595 13:37726045-37726067 AATTCACCAGGCTTGGTGGTGGG + Intronic
1107859556 13:44647895-44647917 AATTAGCCAGACATGGTGGTGGG - Intergenic
1108553069 13:51565669-51565691 AATTAGCCAGACGTAGAGGTGGG - Intergenic
1108619995 13:52172932-52172954 AATTAATCAGACATGGTGGTGGG + Intergenic
1108638705 13:52361762-52361784 AATTAACCAGGCATGGTGGTGGG - Intergenic
1109223455 13:59664297-59664319 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1109443904 13:62407893-62407915 AATTAACCAGGCATGGTGGTGGG + Intergenic
1109633913 13:65088356-65088378 AATTAGCCAGACTTGGTGGCGGG + Intergenic
1110609428 13:77472470-77472492 CATAGACCAGGCCTGGAGGTTGG + Intergenic
1110720943 13:78760862-78760884 CATTGGCCAGACTTAGAGCTTGG + Intergenic
1110815875 13:79859384-79859406 AATTAACCAGGCATGGTGGTAGG + Intergenic
1110900474 13:80816440-80816462 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1111005521 13:82242846-82242868 AATTAACCAGGCATGGTGGTGGG - Intergenic
1111272280 13:85902373-85902395 CATTAGCCAGATATGGTGGTGGG + Intergenic
1111447800 13:88372649-88372671 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1111475923 13:88747443-88747465 AATTCACCAGGCTTGGTGGTAGG - Intergenic
1112499634 13:99932631-99932653 AATTAGCCAGGCTTGGTGGTAGG - Intergenic
1112519971 13:100086565-100086587 CATTAGCCAGGCATGGTGGTAGG - Intergenic
1112943616 13:104896900-104896922 CATTAAACAGATTTGGGGGCAGG + Intergenic
1112987623 13:105470937-105470959 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1113212490 13:108000252-108000274 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
1113219250 13:108079918-108079940 AATTAGCCAGACGTGGTGGTAGG - Intergenic
1113292120 13:108918788-108918810 AATTAGCCAGACTTGGAGGCAGG + Intronic
1113584429 13:111455009-111455031 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1113798890 13:113076411-113076433 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1113844626 13:113379543-113379565 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1113855123 13:113439594-113439616 AATTAGCCAGACATGGTGGTGGG - Intronic
1113929655 13:113960106-113960128 AATTAGCCAGACATGGTGGTGGG + Intergenic
1114169820 14:20261234-20261256 AATTAACCGGGCTTGGTGGTGGG - Intronic
1114236615 14:20829309-20829331 AATTAGCCAGACATGGTGGTGGG + Intergenic
1114326258 14:21591682-21591704 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1114478092 14:23011850-23011872 AATTAGCCAGACTTGGTGGCGGG - Intergenic
1115201295 14:30856864-30856886 AATTAGCCAGACATGGTGGTGGG - Intergenic
1115232314 14:31174394-31174416 AATTAACCAGGCGTGGTGGTGGG + Intronic
1115540335 14:34413449-34413471 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1115592966 14:34881931-34881953 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1115656415 14:35447717-35447739 AATTAGCCAGACATGGTGGTGGG + Intergenic
1115833534 14:37371266-37371288 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1115992001 14:39159969-39159991 AATTAACCAGGCATGGTGGTGGG - Intronic
1116526719 14:45915527-45915549 CAATCACCAGTGTTGGAGGTGGG - Intergenic
1116807670 14:49509568-49509590 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1117444174 14:55787950-55787972 AATTAACCAGGCATGGTGGTGGG - Intergenic
1117568064 14:57016899-57016921 CGTTAGCCAGACATGGTGGTGGG - Intergenic
1117924695 14:60766197-60766219 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1117929365 14:60823708-60823730 CATTAGCCAGGCTTGGTGGCAGG + Intronic
1118313775 14:64711560-64711582 AATTAGCCAGACGTGGTGGTGGG - Intronic
1118388111 14:65273550-65273572 AATTAGCCAGACATGGTGGTGGG + Intergenic
1118575246 14:67235564-67235586 AATTAACCAGGCTTGGTGGCAGG + Intergenic
1118641968 14:67801100-67801122 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1118714475 14:68549171-68549193 CAGTCACCAGCCTTGGAGTTAGG - Intronic
1118834787 14:69469868-69469890 AATTAGCCAGGCATGGAGGTGGG - Intergenic
1118845576 14:69545518-69545540 AATTAGCCAGACATGGCGGTGGG - Intergenic
1119041475 14:71278466-71278488 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1119397073 14:74334379-74334401 CATTACCCAGGCATGGCGGTGGG + Intronic
1119812991 14:77539636-77539658 AATTAGCCAGACTTGGTGGCAGG - Intronic
1119834978 14:77740946-77740968 AATTAACCAGGCATGGTGGTGGG + Intronic
1119997943 14:79273483-79273505 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1120375107 14:83694986-83695008 CAATCACCAGTGTTGGAGGTGGG - Intergenic
1121084635 14:91136533-91136555 AATTAACCAGGCATGGTGGTAGG + Intronic
1121093809 14:91201904-91201926 AATTAACCAGGCATGGTGGTGGG + Intronic
1121195303 14:92066754-92066776 AATTATCCAGGCTTGGTGGTGGG - Intronic
1121229683 14:92347776-92347798 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1121260290 14:92560869-92560891 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1121317458 14:92970779-92970801 AATTAGCCAGACATGGTGGTGGG - Intronic
1122237624 14:100341061-100341083 AATTAACCAGGCTTGGTGGCAGG - Intronic
1122394039 14:101410125-101410147 CACTAACAGGACTTGGAAGTGGG - Intergenic
1122576309 14:102744982-102745004 AATTAGCCAGACATGGTGGTGGG - Intergenic
1122661657 14:103299918-103299940 AATTAGCCAGGCTTGGTGGTAGG + Intergenic
1122734136 14:103825991-103826013 AATTAACCAGGCCTGGTGGTGGG - Intronic
1123002326 14:105301988-105302010 AATTAGCCAGGCTTGGTGGTGGG + Exonic
1202869763 14_GL000225v1_random:150947-150969 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1123712708 15:23001189-23001211 AATTAGCCAGACATGGTGGTGGG - Intronic
1123827080 15:24092876-24092898 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1124110134 15:26777490-26777512 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1124184649 15:27513299-27513321 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1124186829 15:27537986-27538008 AATTAGCCAGACATGGTGGTGGG - Exonic
1124450473 15:29784446-29784468 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1124458790 15:29869953-29869975 AATTAGCCAGACGTGGTGGTGGG - Intronic
1124853052 15:33359765-33359787 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1124923966 15:34053149-34053171 AATTATCCAGACATGGTGGTGGG + Intronic
1125302298 15:38269085-38269107 AATTAGCCAGACATGGTGGTGGG - Intronic
1125640367 15:41225434-41225456 AATTAGCCAGACTTGGTGATGGG + Intronic
1125819279 15:42614160-42614182 AATTAGCCAGACGTGGTGGTGGG + Intronic
1125885162 15:43223823-43223845 AATTAGCCAGACATGGTGGTGGG + Intergenic
1125954245 15:43778110-43778132 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1126025907 15:44446072-44446094 AATTAACCAGGCGTGGTGGTGGG - Intronic
1126759336 15:51955083-51955105 AATTAGCCGGGCTTGGAGGTGGG - Intronic
1126768430 15:52032019-52032041 AATTAGCCAGACGTGGTGGTGGG - Intronic
1126832089 15:52618185-52618207 AATTAGCCAGACGTGGTGGTAGG - Intronic
1126897638 15:53276231-53276253 AATTAACCAGGCATGGTGGTGGG + Intergenic
1126959573 15:53976618-53976640 AATTAGCCAGACTTGGTGGCGGG - Intergenic
1127095310 15:55506996-55507018 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1127132754 15:55884026-55884048 CATTAGCCAGACATGGTGGCAGG - Intronic
1127223972 15:56911190-56911212 AATTAGCCAGGCTTGGTGGTAGG + Intronic
1127509032 15:59622162-59622184 AATTAGCCAGACATGGTGGTGGG + Exonic
1127602045 15:60547473-60547495 AATTACCCAGACGTGGTGGTGGG - Intronic
1127814469 15:62595269-62595291 AATTAACCAGACGTGGTGGTGGG + Intronic
1127967770 15:63936460-63936482 AATTAGCCAGACGTGGTGGTGGG + Intronic
1128027441 15:64450238-64450260 CATTAGCCAGACGTGGTGGCAGG + Intronic
1128143451 15:65318274-65318296 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1128569449 15:68723268-68723290 AATTAACCAGGCATGGTGGTGGG - Intronic
1128573437 15:68752541-68752563 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1128777998 15:70338434-70338456 AATTAACCAGGCATGGCGGTGGG + Intergenic
1129277444 15:74455976-74455998 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1129378215 15:75148062-75148084 AATTAGCCAGACATGGTGGTGGG - Intergenic
1129404443 15:75305916-75305938 AATTACCCAGACGTGGTGGTAGG + Intergenic
1130299855 15:82671893-82671915 AATTAGCCAGACTTGGTGGCGGG + Intronic
1130553406 15:84906166-84906188 CATTAGCCAGGCATGGTGGTGGG - Intronic
1130831533 15:87606111-87606133 AATTAGCCAGACATGGTGGTGGG + Intergenic
1131002048 15:88946794-88946816 AATTAACCAGGCATGGTGGTGGG + Intergenic
1131099708 15:89678359-89678381 AATTAGCCAGACGTGGTGGTGGG + Intronic
1131103449 15:89712973-89712995 AATTAGCCAGACGTGGTGGTGGG + Intronic
1131172266 15:90186782-90186804 AATTAGCCAGACGTGGTGGTGGG + Intronic
1131251850 15:90836192-90836214 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1131791155 15:95967092-95967114 CATTAGCCAGACGTGGTGGTAGG - Intergenic
1132054591 15:98640031-98640053 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1132067315 15:98742886-98742908 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1132484402 16:182885-182907 CTTGAACCAGAGTCGGAGGTTGG + Intergenic
1132494805 16:257392-257414 CATTAGCCAGGCATGGAGGCGGG - Intronic
1132600808 16:772042-772064 AATTAGCCAGACATGGTGGTGGG + Intronic
1132742588 16:1422624-1422646 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1132818147 16:1845369-1845391 AATTAACCAGGCGTGGTGGTGGG + Intronic
1133100259 16:3475236-3475258 AATTAACCAGGCTTGGTGGCGGG - Intronic
1133247476 16:4458855-4458877 AATTAGCCAGACTTGGTGGTGGG + Intergenic
1133312056 16:4854869-4854891 AATTAACCAGACGTGGTGGCGGG - Intronic
1133402597 16:5499719-5499741 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1133444174 16:5846022-5846044 AATTACCCAGGCATGGAGGTGGG + Intergenic
1133499325 16:6350730-6350752 CATTAACAACACTAGGAGGTAGG + Intronic
1133797178 16:9055562-9055584 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1134151606 16:11809694-11809716 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1134170219 16:11962461-11962483 AATTAGCCAGACATGGTGGTGGG + Intronic
1134589556 16:15441524-15441546 AATTAACCAGGCATGGTGGTGGG - Intronic
1134749930 16:16617887-16617909 TATTAGCCAGACATGGTGGTGGG - Intergenic
1134977153 16:18579887-18579909 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1134995547 16:18735728-18735750 TATTAGCCAGACATGGTGGTGGG + Intergenic
1135104958 16:19641211-19641233 AATTAGCCGGACGTGGAGGTGGG - Intronic
1135403078 16:22179662-22179684 AATTAGCCAGACGTGGTGGTGGG + Intronic
1135497284 16:22963725-22963747 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1135624557 16:23982576-23982598 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1135675031 16:24407949-24407971 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1135707798 16:24689896-24689918 AATTAGCCAGCCTTGGTGGTAGG - Intergenic
1135726771 16:24860305-24860327 AATTAGCCAGACGTGGTGGTGGG + Intronic
1135829338 16:25759777-25759799 AATTAACCAGACATGATGGTGGG + Intronic
1136161468 16:28422385-28422407 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1136245319 16:28972357-28972379 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1136304098 16:29357614-29357636 AATTAACCAGGCATGGTGGTGGG - Intergenic
1136528468 16:30849036-30849058 AATTAACCAGGCGTGGTGGTGGG + Intronic
1136627404 16:31470528-31470550 AATTAGCCAGACATGGTGGTGGG - Intergenic
1137412249 16:48238786-48238808 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1137603671 16:49773168-49773190 AATTAGCCAGACATGGTGGTGGG + Intronic
1138459587 16:57140317-57140339 AATTAACCAGGCGTGGTGGTGGG - Intronic
1138632446 16:58309237-58309259 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1138805769 16:60086638-60086660 AATTAACCAGGCATGGTGGTGGG + Intergenic
1138934302 16:61699721-61699743 AATTAACCAGGCGTGGTGGTGGG - Intronic
1139288286 16:65834587-65834609 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1139761085 16:69185394-69185416 CATTAGCCAGGCATGGTGGTGGG - Intronic
1139862607 16:70036910-70036932 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1139993169 16:70955965-70955987 AATTAACCAGATATGGTGGTGGG - Intronic
1140086375 16:71800650-71800672 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1140346749 16:74220709-74220731 TATTAACCAGTCCTGGTGGTGGG + Intergenic
1140414239 16:74762189-74762211 AATTAGCCAGACTTGATGGTGGG - Intronic
1140532032 16:75675038-75675060 AATTAACCAGTCATGGTGGTGGG + Intronic
1141085124 16:81088545-81088567 AATTAACCAGGCATGGTGGTGGG - Intronic
1141169715 16:81683536-81683558 AATTAGCCAGACTTGGTGGCAGG - Intronic
1141340192 16:83196105-83196127 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1141844726 16:86599798-86599820 AATTAGCCAGACATGGTGGTGGG - Intergenic
1141876839 16:86830963-86830985 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1141925382 16:87165230-87165252 AATTAACCAGACGTGGTGGTGGG - Intronic
1142014423 16:87736974-87736996 CATTAGCCAGGCATGGTGGTAGG + Intronic
1142334108 16:89475901-89475923 AATTAACCAGGCGTGGTGGTGGG + Intronic
1142515863 17:428318-428340 AATTAATCAGACATGGTGGTGGG + Intergenic
1142794494 17:2296844-2296866 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1142823180 17:2488406-2488428 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1143170012 17:4923556-4923578 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1143190922 17:5039618-5039640 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1143300675 17:5908514-5908536 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1143470297 17:7169825-7169847 AATTAACCAGGCTTGGTGGTGGG + Intergenic
1143553221 17:7644281-7644303 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1143660183 17:8319782-8319804 AATTAGCCAGACGTGGTGGTGGG - Intronic
1143802129 17:9391992-9392014 CAGTGACCAGACTGGGAGTTGGG - Intronic
1143970706 17:10793210-10793232 AATTAACCAGGCATGGTGGTGGG + Intergenic
1144035675 17:11363354-11363376 CATTAACCAGACTTGGAGGTAGG + Intronic
1144484788 17:15655721-15655743 AATTAACCAGGCATGGTGGTGGG - Intronic
1144500775 17:15785676-15785698 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1144553856 17:16264793-16264815 CATTAGCCAGACGTGGTGGTGGG - Intronic
1144628137 17:16855789-16855811 AATTAGCCAGACATGGTGGTGGG - Intergenic
1144791989 17:17865523-17865545 AATTAGCCAGACTTGGTGGCGGG - Intronic
1144870479 17:18366789-18366811 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1144961726 17:19048003-19048025 AATTAGCCAGACATGGTGGTGGG - Intergenic
1144973435 17:19126521-19126543 AATTAGCCAGACATGGTGGTGGG + Intergenic
1145025683 17:19466311-19466333 AATTAGCCTGACTTGGTGGTGGG + Intergenic
1145159729 17:20566355-20566377 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1145353552 17:22113354-22113376 AATTAGCCAGACATGGTGGTAGG + Intergenic
1145837601 17:27966438-27966460 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1145872780 17:28289361-28289383 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1145895831 17:28457001-28457023 AATTAGCCAGACGTGGTGGTAGG + Intronic
1146196195 17:30815232-30815254 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1146217669 17:30991212-30991234 AATTAGCCAGTCTTGGTGGTGGG + Intronic
1146335552 17:31967048-31967070 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1146729463 17:35181640-35181662 CATTAGCCAGGCATGGTGGTGGG + Intronic
1147011419 17:37451833-37451855 AATTAGCCAGACATGGTGGTGGG + Intronic
1147212669 17:38880952-38880974 CATTAGCCAGATGTGGTGGTGGG + Intronic
1147415952 17:40289855-40289877 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1147858125 17:43498596-43498618 AATTATCCAGGCTTGGTGGTGGG - Intronic
1147881222 17:43654901-43654923 AATTAGCCAGACGTGGTGGTGGG + Intronic
1147984171 17:44295160-44295182 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1148163699 17:45467610-45467632 ACTTAGCCAGACATGGAGGTGGG + Intronic
1148248855 17:46056144-46056166 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1148326775 17:46787805-46787827 AATTAACCAGGCGTGGTGGTGGG + Intronic
1148803343 17:50247887-50247909 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1149186779 17:54007596-54007618 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1149265296 17:54921587-54921609 AATTAACCGGACATGGTGGTGGG + Intronic
1149620656 17:58042544-58042566 AATTAGCCAGACATGGTGGTGGG - Intergenic
1149958690 17:61082498-61082520 AATAATCCAGAGTTGGAGGTAGG - Intronic
1150056236 17:62019890-62019912 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1150075361 17:62187510-62187532 AATTAACCAGACATGGTGGCGGG - Intergenic
1150394928 17:64814263-64814285 ACTTAGCCAGACATGGAGGTGGG + Intergenic
1150453847 17:65291374-65291396 AATTAACCAGGCATGGTGGTGGG - Intergenic
1150549547 17:66196460-66196482 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1150558157 17:66272269-66272291 AATTAACCAGGCATGGTGGTAGG + Intergenic
1150614392 17:66757871-66757893 CATTAGCCAGGCATGGTGGTGGG - Intronic
1150678318 17:67263894-67263916 CATAAAGGAGATTTGGAGGTGGG - Intergenic
1150752573 17:67879288-67879310 AATTAGCCAGACGTGGTGGTGGG - Intronic
1150854313 17:68735903-68735925 AATTAGCCAGGCTTGGTGGTTGG + Intergenic
1150976754 17:70096029-70096051 AATTAGCCAGACATGGTGGTGGG - Intronic
1151150399 17:72080529-72080551 CAATAACAAGACCTGAAGGTGGG + Intergenic
1151243678 17:72778051-72778073 AATTAACCAGGCTTGGTGGCAGG - Intronic
1151247215 17:72804142-72804164 AATTAACCAGACGTGGTGGCGGG - Intronic
1151296079 17:73187123-73187145 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1151540569 17:74762704-74762726 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1151616858 17:75218894-75218916 CATTACCCAGGCATGGTGGTTGG - Intronic
1151734934 17:75933417-75933439 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1151762434 17:76113281-76113303 AATTAGCCAGGCATGGAGGTGGG - Intronic
1151901564 17:77019422-77019444 AATTAGCCAGACGTGGTGGTAGG - Intergenic
1152074577 17:78150972-78150994 CATTAGCCAGGCTTGGTGGCAGG + Intronic
1152093751 17:78260980-78261002 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1152297624 17:79477405-79477427 CATTAGCCAGACGTGGTGGCGGG + Intronic
1152475616 17:80516210-80516232 CATTCCCCAGAGCTGGAGGTGGG + Intergenic
1152581947 17:81169447-81169469 AATTAACCAGACATGGTGGCAGG + Intergenic
1152606121 17:81291336-81291358 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1152848976 17:82620283-82620305 CATTAGCCAGGCATGGCGGTGGG + Intronic
1152932724 17:83118439-83118461 CATGAACCTGGCATGGAGGTTGG + Intergenic
1153345815 18:4024770-4024792 CACTGGCCAGACTTAGAGGTGGG + Intronic
1153621323 18:6980952-6980974 CATTAGCCAGACGTGGTGGTGGG + Intronic
1153866292 18:9272411-9272433 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1154282346 18:13015892-13015914 AATTAGCCAGACATGGTGGTGGG - Intronic
1154389871 18:13927288-13927310 AATTAGCCAGACATGGTGGTAGG + Intergenic
1154408848 18:14124022-14124044 AATTAGCCAGACGTGGTGGTGGG + Intronic
1155023622 18:21920478-21920500 AATTAACCAGACATGGTGGTAGG - Intergenic
1155148242 18:23101689-23101711 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1155573238 18:27218062-27218084 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1155874061 18:31063180-31063202 AATTAACCAGGCGTGGTGGTAGG + Exonic
1155971852 18:32091114-32091136 AATTAACCGGACATGGTGGTGGG - Intergenic
1156196056 18:34775335-34775357 AATTAACCAGGCTTGGTGGTGGG + Intronic
1156619782 18:38835870-38835892 GATTAACCAGGGTTGGAGTTGGG - Intergenic
1156815509 18:41306100-41306122 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1157588032 18:48817625-48817647 AATTAACCAGGCGTGGTGGTGGG + Intronic
1157672388 18:49541348-49541370 AATTAGCCAGACTTGGTGGCAGG - Intergenic
1157817539 18:50741077-50741099 CATTAACCAGGCGTAGTGGTGGG - Intergenic
1157902350 18:51531443-51531465 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1158201120 18:54941942-54941964 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1158455961 18:57608014-57608036 AATTAGCCAGACGTGGTGGTGGG - Intronic
1158909174 18:62042170-62042192 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1158989569 18:62854843-62854865 AATTAACCAGGCGTGGTGGTGGG - Intronic
1159348316 18:67236359-67236381 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1159601439 18:70431886-70431908 AATTAGCCAGACTTGGTGGCGGG + Intergenic
1159669078 18:71200541-71200563 AATTAGCCAGGCTTGGTGGTAGG + Intergenic
1160161333 18:76473650-76473672 AATTATCCAGGCTTGGTGGTGGG + Intronic
1160615285 18:80122066-80122088 AATTAGCCAGACATGGTGGTAGG - Intronic
1160787303 19:906962-906984 AATTAACCAGGCGTGGTGGTGGG - Intronic
1161006163 19:1937921-1937943 CATTAGCCAGTCTTGGTGGTGGG - Intergenic
1161074211 19:2277214-2277236 CATTCCCCAGTGTTGGAGGTGGG + Intronic
1161287875 19:3478186-3478208 CATGAATCAGACTTGGGGCTGGG + Intronic
1161308630 19:3581272-3581294 AATTAGCCAGACATGGTGGTGGG - Intergenic
1161500724 19:4613876-4613898 AATTAACTAGGCTTGGTGGTGGG - Intergenic
1161529584 19:4779804-4779826 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1161600929 19:5182193-5182215 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1161616849 19:5275655-5275677 CATTAGCCAGACATAGTGGTGGG + Intronic
1162053350 19:8048813-8048835 AATTAGCCAGACATGGTGGTAGG + Intronic
1162129117 19:8514574-8514596 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1162153363 19:8660784-8660806 AATTAACCAGGCATGGTGGTGGG - Intergenic
1162304618 19:9864447-9864469 AATTAGCCAGGCATGGAGGTGGG - Intronic
1162408603 19:10491068-10491090 AATTAACCAGGCGTGGTGGTGGG + Intronic
1162478187 19:10913387-10913409 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1162637760 19:11983846-11983868 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1162687982 19:12403699-12403721 AATTAACCAGACATGGTGGTGGG - Intronic
1162700096 19:12508113-12508135 CACTACCCAGACTTAGTGGTTGG + Intronic
1162879289 19:13646205-13646227 AATTAGCCAGACCTGGTGGTGGG - Intergenic
1162905633 19:13821883-13821905 AATTAACCAGGCGTGGTGGTGGG - Intronic
1162928948 19:13946278-13946300 AATTAGCCAGACGTGGTGGTGGG + Intronic
1162997291 19:14344197-14344219 AATTAACCAGGCATGGTGGTGGG + Intergenic
1163142198 19:15357278-15357300 CATTAGCCAGGCATGGTGGTGGG + Intronic
1163225969 19:15961548-15961570 AATTAGCCAGACATGGTGGTGGG + Intergenic
1163331421 19:16640782-16640804 CATTATCCAGGCGTGGTGGTGGG + Intronic
1163354133 19:16798773-16798795 AATTAACCAGGCATGGTGGTGGG - Intronic
1163526168 19:17822827-17822849 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1163760950 19:19136505-19136527 AATTAGCCAGACATGGTGGTGGG + Intronic
1163845489 19:19636053-19636075 CATTAACCAGGCATGGTGGCAGG + Intronic
1163872759 19:19836890-19836912 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1163902565 19:20117578-20117600 AATTAACCAGGCATGGTGGTGGG - Intronic
1163953130 19:20609796-20609818 AATTAACCAGACATGGTGGTGGG - Intronic
1164038791 19:21475966-21475988 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1164085146 19:21894505-21894527 AATTAGCCAGACTTGTTGGTGGG - Intergenic
1164209409 19:23085657-23085679 AATTAGCCAAACTTGGTGGTGGG - Intronic
1164761094 19:30728874-30728896 AATTAACCAGGCATGGTGGTGGG - Intergenic
1164848090 19:31451561-31451583 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1165219500 19:34303762-34303784 AATTAGCCAGACATGGTGGTGGG - Intronic
1165238130 19:34440173-34440195 AATTAACCAGGCGTGGTGGTGGG + Intronic
1165464551 19:35965794-35965816 CATTAAGCAGACTTGAGGGTAGG - Intergenic
1165473872 19:36018431-36018453 CATTAGCCAGATGTGGTGGTGGG + Intronic
1165567400 19:36742837-36742859 AATTAGCCAGACATGGTGGTGGG - Intronic
1165573811 19:36797173-36797195 AATTAACCAGACGTGGTGGCGGG - Intergenic
1165704734 19:37967400-37967422 AATTAACCAGGCATGGTGGTGGG - Intronic
1165765971 19:38351457-38351479 AATTAGCCAGGCTTGGTGGTAGG + Intronic
1165805287 19:38577032-38577054 AATTAGCCAGACGTGGTGGTGGG - Intronic
1165926898 19:39332179-39332201 AATTATCCAGACATGGTGGTGGG + Intronic
1165931438 19:39361773-39361795 AATTAACCGGACATGGTGGTGGG + Intronic
1166099233 19:40561160-40561182 AATTAGCCAGACGTGGTGGTGGG - Intronic
1166191085 19:41177119-41177141 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1166193137 19:41189172-41189194 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1166555126 19:43694151-43694173 AATTCACCAGGCTTGGTGGTGGG - Intergenic
1167005580 19:46774533-46774555 AATTAGCCAGACATGGTGGTGGG - Intronic
1167082451 19:47286238-47286260 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1167178655 19:47884318-47884340 AATTAGCCAGACGTGGTGGTGGG - Intronic
1167312098 19:48742873-48742895 AATTAGCCAGACATGGTGGTGGG - Intronic
1167397354 19:49239461-49239483 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1167549957 19:50153651-50153673 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1167562659 19:50235207-50235229 AATTAGCCAGACATGGTGGTGGG + Intronic
1167646266 19:50706924-50706946 AATTAGCCAGACATGGTGGTGGG - Intronic
1167680891 19:50919997-50920019 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1167751655 19:51384280-51384302 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1167885701 19:52498303-52498325 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1167977871 19:53245861-53245883 AATTAGCCAGACGTGGTGGTGGG + Intronic
1168024089 19:53631140-53631162 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1168223287 19:54976493-54976515 AATTAGCCAGACGTGGTGGTAGG - Intronic
1168237578 19:55073175-55073197 AATTAACCAGGCTTGGTGGTGGG - Intronic
1168251067 19:55142267-55142289 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1168338454 19:55610407-55610429 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1168362393 19:55753052-55753074 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1168483669 19:56742567-56742589 AATTAGCCAGACGTGGTGGTAGG - Intergenic
1168513585 19:56992811-56992833 AATTAAACAGACATGGTGGTGGG + Intergenic
1168514860 19:57002628-57002650 CCAAAACCAGACTTGGAGGGTGG + Intergenic
1168535570 19:57166456-57166478 AATTAACCAGGCGTGGTGGTGGG - Intronic
1168600437 19:57713776-57713798 TATTAGCCAGACATGGTGGTGGG - Intronic
925089161 2:1139378-1139400 AATTAACCAGGCATGGTGGTGGG - Intronic
925117629 2:1393587-1393609 CATTGAACAGACTTCAAGGTAGG - Intronic
925511482 2:4630775-4630797 AATTAACCAGGCATGGTGGTGGG + Intergenic
925516040 2:4682927-4682949 AATTAACCAGGCGTGGTGGTGGG - Intergenic
925909351 2:8563360-8563382 AATTAACCAGGCGTGGTGGTGGG - Intergenic
926189151 2:10714423-10714445 AATTATCCAGACATGGTGGTGGG + Intergenic
926830501 2:16957183-16957205 AATTAGCCAGACGTGGTGGTGGG + Intergenic
927421671 2:22939805-22939827 TATTAACCAGAGATGGATGTAGG - Intergenic
927735243 2:25514829-25514851 AATTAGCCAGGCGTGGAGGTGGG - Intronic
927756613 2:25713494-25713516 AATTATCCAGGCTTGGTGGTAGG + Intergenic
927807527 2:26161288-26161310 AATTAGCCAGACATGGTGGTGGG - Intergenic
927898249 2:26799495-26799517 AATTAGCCAGACGTGGTGGTGGG - Intronic
928131305 2:28653237-28653259 AATTAGCCAGGCTTGGTGGTAGG + Intergenic
928685948 2:33748877-33748899 AATTAGCCAGACTTGGTGGCAGG + Intergenic
928939909 2:36717314-36717336 CATTAGCCAGGCGTGGTGGTGGG - Intronic
929150677 2:38745504-38745526 AATTAGCCAGGCTTGGCGGTGGG + Intronic
929156728 2:38795131-38795153 AATTAACCAGGCATGGAGGCAGG + Intergenic
929771767 2:44898216-44898238 AATTAGCCAGACTTGGTGGCAGG + Intergenic
930029322 2:47048749-47048771 AATTAACCAGACATGGTCGTGGG - Intronic
930729711 2:54716207-54716229 AATTAGCCAGACATGGTGGTGGG - Intergenic
930795567 2:55386618-55386640 AATTAGCCAGCCTTGGTGGTGGG - Intronic
931063797 2:58561650-58561672 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
931110093 2:59101094-59101116 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
931421485 2:62132035-62132057 AATTAGCCAGGCTTGGTGGTGGG - Intronic
931508317 2:62957792-62957814 CATTAGCCAGGCATGGTGGTGGG - Intronic
931773615 2:65520745-65520767 AATTAACCAGGCGTGGTGGTGGG + Intergenic
931783252 2:65598274-65598296 CAAAAACCAGACTTAAAGGTGGG - Intergenic
932155446 2:69412707-69412729 CATTAACCAGGCATGGTGGCAGG + Intronic
932397886 2:71460646-71460668 CATCAGCCAGACTAGGAAGTTGG + Intronic
932544559 2:72694291-72694313 AATTAGCCAGACATGGTGGTGGG + Intronic
932739488 2:74280831-74280853 AATTAACCAGGCATGGTGGTGGG - Intronic
932813027 2:74840102-74840124 AATTAACCGGACATGGTGGTGGG - Intronic
932924505 2:75957045-75957067 AATTAGCCAGACGTGGTGGTGGG - Intergenic
933063244 2:77765083-77765105 AATTAACCAGACATGGTGGCAGG - Intergenic
933207672 2:79527494-79527516 AATTAACCAGGCCTGGTGGTTGG + Intronic
933674931 2:85046479-85046501 AATTAGCCAGATTTGGTGGTGGG + Intronic
933742970 2:85549507-85549529 AATTAGCCAGACGTGGTGGTGGG - Exonic
933826756 2:86168472-86168494 AATTATCCAGACATGGTGGTGGG + Intronic
933845254 2:86320965-86320987 AATTAGCCAGACTTGGTGGCGGG - Intronic
934583018 2:95461918-95461940 AATTAGCCAGACATGGTGGTGGG - Intergenic
934596432 2:95614796-95614818 AATTAGCCAGACATGGTGGTGGG + Intergenic
934608497 2:95716561-95716583 AATTAGCCAGACCTGGTGGTGGG + Intergenic
934732066 2:96665732-96665754 AATTAGCCAGGCTTGGTGGTAGG - Intergenic
934783388 2:96987024-96987046 CATTAACCGGGCTTGGTGGCTGG + Intronic
935030271 2:99315042-99315064 AATTAACCAGGCGTGGTGGTGGG - Intronic
935061525 2:99612262-99612284 AATTAACTAGAGCTGGAGGTTGG - Intronic
935107508 2:100059102-100059124 AATTAGCCAGGCTTGGTGGTGGG + Intronic
935297152 2:101660009-101660031 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
935359041 2:102232258-102232280 AATTAGCCAGACATGGTGGTGGG - Intronic
935561582 2:104565450-104565472 AATTAGCCAGACGTGGTGGTGGG + Intergenic
935723648 2:106002093-106002115 AATTAGCCAGACATGGTGGTGGG - Intergenic
936226096 2:110653854-110653876 AATTAACCAGATGTGGTGGTAGG + Intronic
936288929 2:111203480-111203502 AATTAGCCGGACTTGGTGGTAGG - Intergenic
937308081 2:120884447-120884469 CATTCAGCAGACTCGGAGGAAGG + Intronic
937423277 2:121776186-121776208 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
937537993 2:122914620-122914642 AATTAGCCAGACATGGTGGTGGG - Intergenic
937563099 2:123249065-123249087 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
938200680 2:129370165-129370187 CATTAGCCGGGCTTGGTGGTGGG + Intergenic
938300476 2:130207716-130207738 AATTAACCAGGCGTGGTGGTGGG + Intergenic
938300573 2:130208373-130208395 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
938386634 2:130871385-130871407 AATTAGCCAGGCTTGGTGGTGGG + Intronic
938410624 2:131060998-131061020 AATTAGCCAGGCTTGGTGGTGGG - Intronic
938456153 2:131466098-131466120 AATTAGCCAGGCTTGGTGGTGGG - Intronic
938456252 2:131466759-131466781 AATTAACCAGGCGTGGTGGTGGG - Intronic
938571839 2:132568555-132568577 AATTAGCCAGCCTTGGTGGTGGG + Intronic
938589262 2:132721157-132721179 AATTAGCCAGACGTGGCGGTGGG + Intronic
938604068 2:132874255-132874277 AATTAACCAGGCATGGTGGTGGG - Intronic
938699261 2:133861729-133861751 AATTAGCCAGACGTGGTGGTGGG - Intergenic
938779084 2:134568376-134568398 AATTACCCAGACATGGTGGTGGG + Intronic
938827457 2:135020164-135020186 AATTAGCCAGGCTTGGTGGTGGG - Intronic
939013545 2:136875271-136875293 AATTAGCCAGACATGGTGGTGGG + Intronic
939362120 2:141185928-141185950 AATTAGCCAGGCTTGGTGGTAGG + Intronic
939623692 2:144450822-144450844 AATTAACCAGGCGTGGTGGTGGG - Intronic
940850680 2:158685480-158685502 AATTAGCCAGACTTGGTGGCAGG - Intergenic
941329723 2:164165060-164165082 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
941588835 2:167393083-167393105 AATTAGCCAGACGTGGTGGTGGG + Intergenic
941701651 2:168610124-168610146 AATTAACCAGGCGTGGTGGTGGG - Intronic
941918296 2:170826417-170826439 AATTAGCCAGACGTGGTGGTAGG + Intronic
942032794 2:171979657-171979679 CATTAGCTAGGCTTGGTGGTGGG + Intronic
942060301 2:172223228-172223250 AATTAGCCAGACATGGTGGTGGG + Intergenic
942238177 2:173932841-173932863 CATTAGCCAGGCTTGGCGGTGGG + Intronic
942287293 2:174432910-174432932 AATTAGCCAGACGTGGTGGTGGG - Exonic
942879449 2:180840928-180840950 TATTAGCCAGACGTGGTGGTGGG + Intergenic
942986235 2:182145578-182145600 AATTAGCCAGGCTTGGGGGTGGG + Intronic
943118591 2:183706210-183706232 AATTAACCAGGCATGGAGGCAGG - Intergenic
943186398 2:184612581-184612603 AATTAGCCAGACTTGGTGGTGGG - Intronic
943364795 2:186958696-186958718 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
943438159 2:187892950-187892972 AATTAGCCAGACGTGGTGGTGGG - Intergenic
943519620 2:188931928-188931950 AATTAACCAGACGTGGTGGCGGG + Intergenic
943586777 2:189749972-189749994 AATTAGCCAGACGTGGTGGTGGG + Intronic
943707900 2:191055345-191055367 AATTAGCCAGGCTTGGTGGTGGG - Intronic
944178778 2:196863724-196863746 AATTATCCAGGCTTGGTGGTGGG - Intronic
944218842 2:197282102-197282124 AATTAACCAGGCATGGTGGTGGG + Intronic
944236340 2:197444667-197444689 AATTACCCAGGCTTGGTGGTGGG - Intergenic
944238703 2:197465032-197465054 AATTAGCCAGGCTTGGCGGTGGG - Intronic
944431874 2:199642932-199642954 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
944469051 2:200033407-200033429 AATTAACCAGACATGGTGGTGGG - Intergenic
944567593 2:201006275-201006297 AATTAACCAGGCGTGGTGGTGGG - Intronic
944732563 2:202532086-202532108 AATTAACCAGGCATGGTGGTGGG - Intronic
944914691 2:204346351-204346373 CATTAAACAGATGTGGAGGAAGG - Intergenic
945005218 2:205398150-205398172 AATTAGCCAGGCTTGGTGGTGGG + Intronic
945144315 2:206721002-206721024 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
945291559 2:208132546-208132568 AATTAACCAGGCGTGGTGGTGGG - Intergenic
945313698 2:208346743-208346765 AAATAACCAAACCTGGAGGTTGG + Intronic
945434126 2:209798824-209798846 AATTAGCCAGGCTTGGTGGTGGG - Intronic
945915965 2:215704222-215704244 AATTAACCGGGCTTGGTGGTGGG - Intergenic
945925476 2:215798992-215799014 AATTAGCCAGACATGGTGGTGGG - Intergenic
946176787 2:217927216-217927238 CATTAAAAAGGCATGGAGGTGGG + Intronic
946390246 2:219410910-219410932 AATTAGCCAGACATGGTGGTGGG - Intergenic
946590720 2:221244281-221244303 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
946847051 2:223868628-223868650 AATTAACCAGGCGTGGTGGTGGG + Intronic
947176827 2:227375636-227375658 AATTAGCCAGGCTTGGTGGTGGG - Intronic
947196353 2:227572073-227572095 AATTAGCCAGACATGGTGGTGGG + Intergenic
947464791 2:230333305-230333327 AATTAGCCAGACGTGGTGGTGGG - Intronic
947618106 2:231571375-231571397 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
947965247 2:234274880-234274902 AATTAGCCAGACATGGTGGTGGG + Intergenic
947968479 2:234302116-234302138 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
948719681 2:239891157-239891179 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1168743259 20:213147-213169 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1168950324 20:1794536-1794558 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1169253338 20:4077408-4077430 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1169361950 20:4957750-4957772 AATTAGCCAGACATGGTGGTGGG + Intronic
1169782836 20:9327625-9327647 AATTAGCCAGACGTGGTGGTGGG + Intronic
1170257216 20:14358603-14358625 AATTAGCCAGACGTGGTGGTGGG - Intronic
1170301985 20:14894377-14894399 CATTAGCCGGACGTGGTGGTGGG - Intronic
1170376441 20:15705566-15705588 AATTAACCAGACGTGGTGGAGGG - Intronic
1170674273 20:18464822-18464844 AATTAGCCAGACATGGTGGTGGG - Intronic
1171045683 20:21808117-21808139 AATCTACCAGACTTGGGGGTAGG + Intergenic
1171769153 20:29308682-29308704 AATTAGCCTGACTTGGTGGTGGG + Intergenic
1171984270 20:31648622-31648644 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1172002956 20:31794967-31794989 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1172131311 20:32657809-32657831 AATTAGCCAGACATGGTGGTGGG + Intergenic
1172224353 20:33295455-33295477 AATTAGCCAGACATGGTGGTGGG + Intronic
1172396096 20:34606907-34606929 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1172415595 20:34764535-34764557 AATTAGCCAGACATGGTGGTGGG + Intronic
1172456967 20:35084151-35084173 AATTAGCCAGACTTGGTGGCGGG + Intronic
1172494195 20:35366943-35366965 AATTAACCAGGCGTGGTGGTGGG + Intronic
1172558498 20:35865041-35865063 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1172677358 20:36683093-36683115 AATTAACCAGACATGGTGGCGGG + Intronic
1172912078 20:38417209-38417231 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1173540504 20:43847607-43847629 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1173612203 20:44377612-44377634 AATTAACCAGGCCTGGTGGTGGG + Intronic
1173625950 20:44473217-44473239 CATTAACCAGGCATGGTGGCAGG - Intergenic
1173837180 20:46133642-46133664 AATTAACCAGGCATGGTGGTGGG - Intergenic
1174015336 20:47483574-47483596 AATTAGCCAGACTTGGTGGCGGG - Intergenic
1174215851 20:48915651-48915673 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1174252212 20:49228282-49228304 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1174362257 20:50036264-50036286 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1174394256 20:50236848-50236870 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1174591793 20:51651778-51651800 AATTAACCAGGCATGGTGGTGGG + Intronic
1174597949 20:51699789-51699811 AATTAGCCAGTCTTGGTGGTGGG - Intronic
1174636756 20:52007679-52007701 AATTAGCCAGACTTGGTGGCGGG + Intergenic
1174956314 20:55102747-55102769 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1175461685 20:59156375-59156397 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1176204021 20:63878488-63878510 CATCAACCAAACAGGGAGGTGGG + Intronic
1176210488 20:63918741-63918763 CATTAGCCAGGCATGGTGGTGGG - Intronic
1176332982 21:5566749-5566771 CATTATCCAGGCATGGAGGCAGG - Intergenic
1176394775 21:6254203-6254225 CATTATCCAGGCATGGAGGCAGG + Intergenic
1176419537 21:6503181-6503203 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1176442382 21:6734902-6734924 CATTATCCAGGCATGGAGGCAGG - Intergenic
1176466644 21:7061971-7061993 CATTATCCAGGCATGGAGGCAGG - Intronic
1176490205 21:7443749-7443771 CATTATCCAGGCATGGAGGCAGG - Intergenic
1176518262 21:7803270-7803292 AATTAACCAGGCATGGTGGTGGG + Intergenic
1176524465 21:7855526-7855548 CATTAGCCAGATGTGGTGGTAGG + Intergenic
1176955827 21:15102233-15102255 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1177405846 21:20667015-20667037 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1177433418 21:21020182-21020204 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1177531013 21:22357804-22357826 AATTAGCTAGACTTGGTGGTTGG + Intergenic
1177708913 21:24745250-24745272 AATTAACCAGGCTTGGTGGCAGG + Intergenic
1177741040 21:25154264-25154286 AATTAACCAGATGTGGTGGTGGG - Intergenic
1177848518 21:26319351-26319373 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1178178171 21:30129079-30129101 AATTAACCAGGCATGGTGGTGGG + Intergenic
1178259547 21:31086151-31086173 AATTAACCAGCCGTGGTGGTGGG + Intergenic
1178533479 21:33393947-33393969 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1178550689 21:33536272-33536294 AATTTACCTGACTTGCAGGTTGG - Intronic
1178652290 21:34433283-34433305 AATTAACCAGGCATGGTGGTGGG + Intergenic
1178658485 21:34485539-34485561 CATTAGCCAGATGTGGTGGTAGG + Intergenic
1178676203 21:34633871-34633893 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1178708847 21:34896532-34896554 AATTAGCCAGACATGGTGGTGGG + Intronic
1179119320 21:38528290-38528312 CATTAGCCAGGCATGGTGGTGGG + Intronic
1179179384 21:39032218-39032240 CATTAGCCAGGCATGGGGGTGGG + Intergenic
1179417975 21:41213623-41213645 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1179535192 21:42046891-42046913 AATTAACCAGACATGGTGGAGGG - Intergenic
1179695030 21:43111504-43111526 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1179899513 21:44381756-44381778 CATTATCCAGGCATGGTGGTGGG + Intronic
1180118995 21:45733747-45733769 AATTAACCAGGCGTGGTGGTGGG - Intronic
1180622968 22:17174168-17174190 AATTAGCCAGACATGGTGGTGGG - Intergenic
1180719249 22:17894646-17894668 AATTAGCCAGGCGTGGAGGTGGG + Intronic
1180740010 22:18046779-18046801 AATTAGCCAGACATGGTGGTGGG - Intergenic
1180781830 22:18524751-18524773 GATTAGCCAGACGTGGTGGTGGG + Intergenic
1181136595 22:20771272-20771294 CATTAGCCAGACGTGGTGGTGGG + Intronic
1181185277 22:21098910-21098932 CATTAGCCAGGCATGGCGGTGGG - Intergenic
1181238716 22:21464094-21464116 GATTAGCCAGACGTGGTGGTGGG + Intergenic
1181548306 22:23618260-23618282 AATTAGCCAGACGTGGTGGTGGG - Intronic
1181765811 22:25091204-25091226 AATTAGCCAGACATGGTGGTGGG - Intronic
1182236206 22:28878852-28878874 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1182314948 22:29439482-29439504 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1182330330 22:29546987-29547009 AATTAGCCAGACATGGTGGTGGG - Intronic
1182474891 22:30571713-30571735 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1182804816 22:33060455-33060477 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1182926037 22:34126239-34126261 CATTATCCAGGCTTGGTGGTGGG + Intergenic
1183017832 22:35004483-35004505 CATTAACCAGGCATGGTGGTGGG - Intergenic
1183064950 22:35356384-35356406 AATTAGCCAGACGTGGAGGCGGG + Intergenic
1183117845 22:35705609-35705631 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1183403684 22:37619525-37619547 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1183497686 22:38158316-38158338 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1183570388 22:38648822-38648844 AATTAGCCAGACGTGGTGGTGGG + Intronic
1183997134 22:41643258-41643280 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1184363829 22:44036106-44036128 AATTAACCAGGCGTGGTGGTGGG + Intronic
1184494137 22:44827489-44827511 CATTAGCCAGGCATGGCGGTGGG - Intronic
1184510124 22:44928556-44928578 AATTAGCCAGACATGGTGGTGGG - Intronic
1185259223 22:49852644-49852666 AATTAGCCAGACGTGGTGGTGGG - Intergenic
949265730 3:2154234-2154256 CATTAACCGGATGTGGTGGTGGG + Intronic
949418784 3:3842255-3842277 AAGTAACCAGACTTGGAGATGGG + Intronic
949550760 3:5111019-5111041 AATTAGCCAGACATGGGGGTGGG + Intergenic
950091220 3:10296464-10296486 AATTAGCCAGACATGGTGGTAGG - Intronic
950331963 3:12163091-12163113 AATTAGCCAGACGTGGTGGTGGG + Intronic
950340573 3:12240567-12240589 AATTAGCCAGACATGGTGGTGGG - Intergenic
950506986 3:13401108-13401130 AATTAACCAGGCTTGGTGGCAGG + Intronic
950918099 3:16665830-16665852 AATTAGCCAGACATGGTGGTGGG - Intronic
952038188 3:29229885-29229907 TATTAACAAGACTTGGAGGTGGG - Intergenic
952381164 3:32806561-32806583 AATTAGCCAGACGTGGTGGTGGG - Intergenic
952494964 3:33907805-33907827 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
953257289 3:41304122-41304144 AATTAGCCAGACGTGGTGGTGGG + Intronic
954021285 3:47744288-47744310 AATTAGCCAGACTTGGTGGCAGG - Intronic
954050219 3:47969257-47969279 AATTAGCCAGACATGGTGGTGGG + Intronic
954068840 3:48128206-48128228 AATTAGCCAGACTTGGTGGTGGG + Intergenic
954094323 3:48312492-48312514 AATTACCCAGGCTTGGTGGTGGG + Intronic
954284037 3:49605109-49605131 AATTAGCCAGACATGGTGGTGGG + Intronic
954297142 3:49680614-49680636 CACTCACCAGGGTTGGAGGTAGG - Exonic
954350073 3:50035906-50035928 AATTAGCCAGACATGGTGGTGGG - Intronic
954561727 3:51562378-51562400 AATTAGCCAGACATGGTGGTGGG - Intronic
954588713 3:51761048-51761070 AATTATCCAGACGTGGTGGTGGG + Intergenic
954732628 3:52677559-52677581 AATTAGCCAGGCTTGGTGGTGGG - Intronic
955234475 3:57127552-57127574 AATTAGCCAGACATGGTGGTGGG - Intronic
955486240 3:59437684-59437706 AATTAGCCAGACTTGGTGGCGGG + Intergenic
955710301 3:61771909-61771931 AATTAACCAGGCATGGTGGTAGG + Intronic
955745788 3:62139308-62139330 AATTAACCAGGCTTGGTGGCGGG + Intronic
956101389 3:65772050-65772072 AATTTGCCAGACTTGGTGGTGGG + Intronic
956443258 3:69300882-69300904 AATTAGCCAGGCTTGGTGGTGGG - Intronic
956773488 3:72546675-72546697 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
956822463 3:72966125-72966147 CATTAGCCAGGCATGGAGGCAGG - Intronic
956834028 3:73081051-73081073 AATTAGCCAGACGTGGTGGTGGG - Intergenic
957295862 3:78331538-78331560 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
957304982 3:78445698-78445720 AATTAACCAGACGTGGTGGCGGG + Intergenic
958083651 3:88779231-88779253 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
958098230 3:88974552-88974574 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
958609069 3:96400963-96400985 AATTAGCCAGGCGTGGAGGTGGG + Intergenic
959124732 3:102277262-102277284 AATTAACCGGGCTTGGTGGTGGG - Intronic
959689756 3:109186008-109186030 CATTAGCCAGACATGGTGGCAGG + Intergenic
959930507 3:111977151-111977173 AATTAACCAGGCATGGTGGTCGG + Intergenic
960004780 3:112770845-112770867 AATTAACCAGGCGTGGTGGTGGG + Intronic
960027235 3:113023168-113023190 CATTAGCCAGACATGGTGGTGGG - Intergenic
960039959 3:113140657-113140679 AATTAGCCAGACATGGTGGTGGG + Intergenic
960397409 3:117154138-117154160 AATTAGCCAGACGTGGCGGTGGG + Intergenic
960417774 3:117406280-117406302 AATTAGCCAGACATGGTGGTAGG - Intergenic
960485386 3:118245810-118245832 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
960629942 3:119719952-119719974 AATTAGCCAGACGTGGTGGTGGG + Intronic
960803158 3:121558812-121558834 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
960862780 3:122168596-122168618 AATTAGCCAGACATGGTGGTAGG - Intergenic
961150422 3:124632918-124632940 CATTTGCCAGATTTGGAGATAGG + Intronic
961286220 3:125806500-125806522 AATTAGCCAGACATGGTGGTAGG - Intergenic
961442788 3:126962699-126962721 CATGAGCCAGACATGGAGGTGGG - Intergenic
961697922 3:128719177-128719199 AATTAGCCAGACGTGGTGGTAGG - Intergenic
961758914 3:129150562-129150584 AATTAGCCAGACGTGGTGGTGGG + Intronic
961760565 3:129164245-129164267 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
961900541 3:130206447-130206469 AATTAACCAGCCATGGTGGTAGG + Intergenic
962214637 3:133510699-133510721 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
962217917 3:133538740-133538762 AATTAGCCAGACATGGTGGTGGG + Intergenic
962302776 3:134257854-134257876 AATTAACCAGGCTTGGTGGCGGG - Intergenic
962483066 3:135814626-135814648 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
962783487 3:138744244-138744266 CATTAGCCAGGCGTGGTGGTGGG + Intronic
962867960 3:139463333-139463355 AATTAACCAGACATGGTGGTGGG - Intronic
963006955 3:140735349-140735371 AATTAGCCAGACATGGTGGTGGG - Intergenic
963184798 3:142402329-142402351 AATTAGCCAAACTTGGTGGTGGG - Intronic
963440699 3:145335713-145335735 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
963808726 3:149753328-149753350 CATTAGCCAGGCATGGTGGTGGG - Intergenic
964039105 3:152237448-152237470 AATTAACCAGGCGTGGTGGTGGG + Intergenic
964105392 3:153034254-153034276 AATTAGCCAGACATGGTGGTGGG - Intergenic
964362335 3:155911688-155911710 AATTAGCCAGTCTTGGTGGTGGG + Intronic
964400828 3:156296620-156296642 CATTAGCCAGGCATGGTGGTGGG - Intronic
964449411 3:156796651-156796673 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
964546413 3:157839084-157839106 AATTAGCCAGACCTGGTGGTGGG + Intergenic
964718743 3:159750728-159750750 CATTAACCACATTTGGTGATGGG + Intronic
964835826 3:160937469-160937491 AATTAGCCAGACGTGGTGGTGGG + Intronic
965214237 3:165840483-165840505 AATTAGCCAGATTTGGTGGTGGG - Intergenic
965287125 3:166830364-166830386 TATTATCCACACTTTGAGGTAGG + Intergenic
965499590 3:169441877-169441899 CATTAGCCAGGCGTGGTGGTGGG - Intronic
965506873 3:169525878-169525900 AATTAGCCAGACGTGGTGGTGGG + Intronic
965811472 3:172595174-172595196 AATTAGCCAGACGTGGTGGTGGG - Intergenic
966224570 3:177584109-177584131 TATTAGCCAGACATGGTGGTGGG - Intergenic
966524698 3:180908058-180908080 AATTAGCCAGACGTGGTGGTGGG - Intronic
966584029 3:181601712-181601734 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
966646471 3:182251169-182251191 AATTAGCCAGTCTTGGTGGTGGG - Intergenic
966713195 3:182990087-182990109 AATTAGCCAGACGTGGTGGTGGG - Intergenic
966729319 3:183137167-183137189 AATTAGCCAGGCATGGAGGTGGG + Intronic
966770153 3:183497126-183497148 AATTAACCAGGCATGGTGGTGGG + Intronic
966810062 3:183835716-183835738 AATTAGCCAGACGTGGTGGTGGG + Intronic
967161083 3:186738695-186738717 AATTAGCCAGGCGTGGAGGTGGG + Intronic
967227804 3:187309404-187309426 AATTAGCCAGACATGGTGGTGGG - Intergenic
967466372 3:189810705-189810727 AATTAGCCAGACGTGGTGGTGGG + Intronic
967522834 3:190454812-190454834 AATTAGCCAGACATGGTGGTGGG - Intergenic
967906425 3:194504650-194504672 AATTAGCCAGACATGGTGGTGGG + Intergenic
967978933 3:195053794-195053816 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
968041675 3:195594280-195594302 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
968095939 3:195930959-195930981 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
968197315 3:196718159-196718181 CATTAGCCAGGCGTGGTGGTGGG + Intronic
968700331 4:2053778-2053800 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
968802359 4:2751622-2751644 CATTAGCCAGGCATGGTGGTGGG + Intronic
968824443 4:2883818-2883840 AATTAGCCAGACGTGGTGGTGGG - Intronic
969124813 4:4939085-4939107 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
969182179 4:5450749-5450771 CATTCATCAGTCTTGGAGCTGGG - Intronic
969341993 4:6548067-6548089 AATTAACCAGGCATGGTGGTGGG + Intronic
970385258 4:15549652-15549674 CATTAGCCAGGCGTGGTGGTGGG + Intronic
970698902 4:18711338-18711360 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
970897756 4:21123063-21123085 AATTAACCGGACTTGGTGGCGGG + Intronic
971128360 4:23778883-23778905 AATTAGCCAGGCTTGGTGGTGGG + Intronic
971355808 4:25894313-25894335 AATTAGCCAGGCTTGGTGGTGGG + Intronic
971402019 4:26285003-26285025 AATTAACCAGGCGTGGTGGTGGG - Intronic
971709770 4:30095691-30095713 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
971747690 4:30605499-30605521 CATTATCCTGACCTAGAGGTAGG - Intergenic
972073953 4:35060004-35060026 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
972407217 4:38758203-38758225 CAACAAACAGACTTGGAGGGAGG - Intergenic
972445088 4:39136306-39136328 AATTAGCCAGACTTGGTGGTGGG - Intergenic
972494254 4:39618496-39618518 AATTAGCCAGGCTTGGTGGTTGG + Intronic
972579743 4:40384850-40384872 AATTAACCAGGCATGGTGGTGGG - Intergenic
972596656 4:40535518-40535540 AATTAGCCAGACGTGGTGGTGGG - Intronic
972597817 4:40545513-40545535 AATTAACCAGGCGTGGTGGTGGG + Intronic
973154925 4:46938983-46939005 CATTACCCAGCCTGGGAGATGGG + Intronic
973229565 4:47825850-47825872 AATTGACCAGACATGGTGGTGGG - Intronic
973816216 4:54621798-54621820 AATTAGCCAGACATGGAGGCAGG + Intergenic
973979398 4:56294763-56294785 AATTAACCAGGCGTGGTGGTGGG + Intronic
974027451 4:56746219-56746241 AATTAGCCAGACATGGTGGTGGG + Intergenic
974035548 4:56814810-56814832 AATTAGCCAGACATGGTGGTGGG + Intronic
974600614 4:64074769-64074791 AATTAGCCAGACGTGGTGGTGGG + Intergenic
974742843 4:66029509-66029531 AATTAGCCAGACGTGGTGGTAGG + Intergenic
975055249 4:69922604-69922626 AATTAACCAGCCATGGTGGTGGG - Intergenic
975093506 4:70430653-70430675 GTTTGACCAGACTTGGAGGAAGG + Exonic
975560989 4:75708286-75708308 CATTAGCCAGGCTTGATGGTAGG - Intronic
976409958 4:84702154-84702176 AATTAGCCAGACGTGGTGGTGGG - Intronic
976542666 4:86296025-86296047 AATTAGCCAGGCTTGGTGGTGGG + Intronic
976607584 4:86997058-86997080 AATTAGCCAGACATGGTGGTGGG - Intronic
977039252 4:91994550-91994572 AATTAGCCAGATGTGGAGGTGGG + Intergenic
977259997 4:94786685-94786707 AATTAACCAGGCATGGTGGTGGG - Intronic
978380707 4:108125310-108125332 AATTAACCAGGCGTGGCGGTGGG - Intronic
978451206 4:108836018-108836040 AATTAGCCAGGCTTGGTGGTGGG - Intronic
978515809 4:109567556-109567578 AATTAGCCAGCCTTGGTGGTGGG - Intronic
978587068 4:110284668-110284690 AATTAACCAGATGTGGTGGTAGG + Intergenic
978995334 4:115144188-115144210 AATTAGCCAGACGTGGTGGTGGG + Intergenic
979149184 4:117286753-117286775 AATTAGCCAGACATGGTGGTGGG + Intergenic
979241639 4:118452327-118452349 AATTATCCAGACATGGTGGTGGG + Intergenic
979348800 4:119622023-119622045 CATTAGCCAGGCATGGTGGTGGG + Intronic
979361782 4:119773766-119773788 TAATAACCAGTATTGGAGGTGGG - Intergenic
979384167 4:120044172-120044194 TATTAACCAGGCATGGTGGTGGG + Intergenic
980639328 4:135555039-135555061 CATTATACAGAATTGGAGGAAGG - Intergenic
980990059 4:139731467-139731489 AATTAGCCAGACATGGTGGTGGG + Intronic
981088623 4:140709707-140709729 CATGGACCAGAGTTGGGGGTGGG + Intronic
981386041 4:144131950-144131972 AATTAGCCAGGCTTGGTGGTGGG - Intronic
981473224 4:145160959-145160981 AATTAGCCAGACTTGGTGGCGGG + Intronic
981668935 4:147262745-147262767 AATTAACCAGACGTGGTGGTAGG + Intergenic
981767518 4:148268085-148268107 AATTAGCCAGGCTTGGTGGTGGG - Intronic
981931709 4:150197004-150197026 AATTAACCAGGCGTGGTGGTGGG + Intronic
982167581 4:152628783-152628805 AATTAGCCAGGCTTGGTGGTGGG - Intronic
982465379 4:155723809-155723831 AATTAGCCAGACGTGGAGGCGGG - Intronic
982486907 4:155977227-155977249 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
983270127 4:165551384-165551406 AATTAGCCAGACGTGGTGGTGGG + Intergenic
983689909 4:170455854-170455876 AATTAACCAGGCATGGTGGTGGG - Intergenic
983919338 4:173328932-173328954 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
983989334 4:174098468-174098490 AATTAGCCAGACGTGGTGGTGGG + Intergenic
984279582 4:177653118-177653140 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
984408577 4:179366441-179366463 AATTAGCCAGACATGGTGGTGGG + Intergenic
984731206 4:183069679-183069701 CATTCAAAAGATTTGGAGGTGGG - Intergenic
984760799 4:183361027-183361049 AATTAGCCAGACATGGTGGTGGG + Intergenic
984997775 4:185452744-185452766 AATTAACCAGGCATGGTGGTGGG + Intronic
984998545 4:185461947-185461969 AATTAACCAGGCATGGTGGTGGG + Intronic
986517015 5:8574771-8574793 AATTAGCCAGACGTGGTGGTGGG - Intergenic
986777973 5:11036567-11036589 AATTAGCCAGGCTTGGTGGTGGG - Intronic
986835326 5:11630803-11630825 CATTAGCCAGGCGTGGTGGTGGG + Intronic
986840487 5:11691220-11691242 AATTAACCAGGCGTGGTGGTGGG + Intronic
987046924 5:14117095-14117117 AATTAACCAGGCATGGAGGCGGG + Intergenic
987202174 5:15588533-15588555 AATTAGCCAGACGTGGTGGTGGG - Intronic
987349654 5:17010587-17010609 AATTAACCGGGCTTGGTGGTGGG - Intergenic
987828077 5:23059827-23059849 AATTAACCAGGCATGGTGGTAGG - Intergenic
987985522 5:25141146-25141168 AATTAACCAGGCATGGTGGTGGG - Intergenic
988300842 5:29424331-29424353 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
988518224 5:31923144-31923166 AATTAGCCAGGCTTGGTGGTGGG + Intronic
988528089 5:32003858-32003880 AATTAGCCAGACGTGGTGGTGGG - Intronic
988537280 5:32080197-32080219 AATTAGCCAGACGTGGTGGTGGG + Intronic
988559968 5:32272140-32272162 AATTAGCCAGGCTTGGTGGTGGG + Intronic
988659187 5:33246319-33246341 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
988718382 5:33851261-33851283 AATTAACCAGGCATGGTGGTGGG + Intronic
989469559 5:41799368-41799390 TATTAAACTGACTTGGAGCTTGG + Intronic
989626564 5:43435263-43435285 AATTAGCCAGACATGGTGGTGGG - Intergenic
989718131 5:44490974-44490996 AATTAGCCAGGCTTGGTGGTAGG - Intergenic
989806312 5:45611418-45611440 CATTAGCCAAACATGGTGGTGGG - Intronic
990005829 5:50943344-50943366 CATTAGCCAGGCATGGTGGTGGG + Intergenic
990147117 5:52774748-52774770 AATTAGCCAGACATGGTGGTGGG + Intergenic
990423514 5:55661294-55661316 CATTAGCCAGGCATGGTGGTGGG + Intronic
990424019 5:55667044-55667066 AATTAACCAGGCGTGGTGGTGGG + Intronic
990599205 5:57340388-57340410 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
990702055 5:58484440-58484462 CATTAGCCAGGCATGGTGGTGGG - Intergenic
991694892 5:69261677-69261699 AATTAACCAGGCATGGTGGTGGG - Intronic
992140762 5:73794753-73794775 AATTAGCCAGACGTGGTGGTGGG - Intronic
992630992 5:78680297-78680319 AATTAACCAGGCATGGTGGTGGG + Intronic
993368988 5:87068765-87068787 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
993488171 5:88512846-88512868 AATTAACCAGGCTTGGTCGTGGG - Intergenic
993963454 5:94330987-94331009 AATTAGCCAGACGTGGTGGTGGG + Intronic
994146077 5:96396410-96396432 AATTAGCCAGGCTTGGTGGTGGG + Intronic
994715878 5:103321050-103321072 AATTAGCCAGACATGGTGGTGGG - Intergenic
995155880 5:108912508-108912530 AATTAGCCAGGCTTGGTGGTGGG - Intronic
995235323 5:109822824-109822846 AATTAGCCAGACTTGGTGGCGGG - Intronic
995274873 5:110266768-110266790 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
995308078 5:110678211-110678233 AATTAGCCAGGCTTGGTGGTGGG - Intronic
995895299 5:117004478-117004500 AATTAACCAGGCGTGGTGGTGGG - Intergenic
996028868 5:118683166-118683188 CTTTACCCAGATTTTGAGGTAGG - Intergenic
996135563 5:119837710-119837732 AATTAGCCAGACATGGTGGTGGG - Intergenic
996550338 5:124723537-124723559 AATTAACCAGTCATGGTGGTGGG + Intronic
996732620 5:126730359-126730381 TATTAGCCAGGCTTGGTGGTGGG + Intergenic
996991331 5:129636043-129636065 AATTAACCAGACGTGGTGGCAGG - Intronic
997345974 5:133192431-133192453 AATTAGCCAGACATGGTGGTGGG - Intergenic
997363710 5:133311995-133312017 CATTAACCAGAGGTGGTGCTGGG - Intronic
997442354 5:133917760-133917782 CATTAATGAGACTTGCAGGGGGG + Intergenic
997671571 5:135679187-135679209 CAGTCCCCAGACTTGCAGGTGGG + Intergenic
998013764 5:138716314-138716336 AATTAGCCAGACGTGGTGGTGGG - Intronic
998120563 5:139573151-139573173 AATTAGCCAGACGTGGTGGTGGG + Intronic
998158739 5:139801054-139801076 AATTAACCAGGCATGGTGGTGGG + Intronic
998402437 5:141854818-141854840 AATTAACCAGATATGGTGGTGGG - Intronic
998444919 5:142191265-142191287 AATTAGCCAGACATGGTGGTGGG + Intergenic
998470194 5:142377728-142377750 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
999193831 5:149768590-149768612 AATTAGCCAGACGTGGTGGTGGG - Intronic
999404115 5:151292007-151292029 AATTAGCCAGGCTTGGTGGTGGG - Intronic
999404235 5:151292833-151292855 AATTAACCAGGCGTGGTGGTGGG + Intronic
999669175 5:153943865-153943887 CATTAGCCTGACTTTGGGGTGGG - Intergenic
1000157671 5:158567869-158567891 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1000320208 5:160128645-160128667 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1000732690 5:164855963-164855985 CATTAGCCAGACTTGGTGGCAGG + Intergenic
1000885918 5:166746976-166746998 AATTAACCAGGCATGGTGGTGGG + Intergenic
1000960920 5:167599995-167600017 AATTAGCCAGACGTGGTGGTGGG + Intronic
1001102637 5:168826909-168826931 AATTAGCCAGACGTGGTGGTGGG - Intronic
1001142233 5:169154119-169154141 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1001264686 5:170265134-170265156 AATTAACCAGGCATGGTGGTGGG - Intronic
1001809487 5:174617105-174617127 AATTAACCAGGCATGGTGGTGGG - Intergenic
1002281323 5:178131511-178131533 CATTAACCAAAACTGGAGGGAGG - Intronic
1002287898 5:178177514-178177536 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1002480814 5:179499557-179499579 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1003281682 6:4698113-4698135 AATTAGCCAGACATGGTGGTGGG - Intergenic
1003358997 6:5405639-5405661 AATTAACCAGGCGTGGTGGTGGG - Intronic
1003401068 6:5791397-5791419 AATTAGCCAGACATGGTGGTAGG - Intergenic
1003441719 6:6148898-6148920 CATGAATTAGACTTGGAGGAAGG + Intronic
1003651668 6:7966718-7966740 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1004368807 6:15034571-15034593 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1004390185 6:15203505-15203527 AATTAACCGGACGTGGTGGTGGG - Intergenic
1004907585 6:20250879-20250901 CATTTTCCAGGCTTGAAGGTGGG + Intergenic
1004992029 6:21149289-21149311 AATTAGCCAGGCCTGGAGGTGGG - Intronic
1005007323 6:21301055-21301077 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1005314057 6:24587427-24587449 AATTAGCCAGACGTGGTGGTGGG - Intronic
1005418065 6:25622322-25622344 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1006525995 6:34605478-34605500 CATTAGCCAGGCATGGTGGTGGG + Intronic
1006635777 6:35460261-35460283 AATTAACCAGGCTTGGTGGTGGG - Intronic
1007115055 6:39337459-39337481 AATTAGCCAGACGTGGTGGTGGG - Intronic
1007215398 6:40233680-40233702 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1007428441 6:41762175-41762197 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1008503722 6:52208851-52208873 TATGAGCCACACTTGGAGGTGGG - Intergenic
1008528970 6:52436788-52436810 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1009417739 6:63434289-63434311 AATTAGCCAGACATGGTGGTGGG + Intergenic
1009910021 6:69914274-69914296 CATCAACCAGCCTGGGAGGAAGG + Intronic
1010078183 6:71826318-71826340 AATTAACCAGACGTGGTGGTGGG + Intergenic
1010089799 6:71967237-71967259 AATTAACCAGGCGTGGTGGTGGG + Intronic
1010173398 6:72998586-72998608 CATTAGCCGGGCTTGGTGGTGGG + Intronic
1010435104 6:75820516-75820538 AATTAGCCAGACATGGTGGTGGG - Intronic
1011283917 6:85704341-85704363 AATTAACCAGGCATGGTGGTGGG + Intergenic
1011546579 6:88487856-88487878 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1011654762 6:89541539-89541561 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1011655702 6:89549945-89549967 AATTAGCCAGACTTGGTGGCAGG + Intronic
1012192757 6:96300728-96300750 CATTAGCCAGACATGGTGGCAGG + Intergenic
1013101356 6:106989619-106989641 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1013213420 6:108006518-108006540 CATTAGCCAGACATGGTGGCGGG - Intergenic
1013452853 6:110302127-110302149 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1013495439 6:110692846-110692868 CATTAGCCAGACATGTTGGTGGG + Intronic
1013785530 6:113775663-113775685 AATTATCCAGACTTGGTGGTGGG - Intergenic
1013855437 6:114566656-114566678 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1014037848 6:116788354-116788376 AATTAGCCAGGCTTGGTGGTAGG + Intergenic
1014228881 6:118879893-118879915 AATTAACCAGGCGTGGTGGTGGG + Intronic
1014775013 6:125498578-125498600 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1014810451 6:125879853-125879875 CAGTAGCCAGGCTTGGTGGTGGG + Intronic
1015101616 6:129488159-129488181 CATTAGCCAGACATGGTGGTAGG + Intronic
1015219042 6:130782965-130782987 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1015256188 6:131181975-131181997 CATTAGCCAGGCATGGTGGTGGG + Intronic
1015363900 6:132375572-132375594 CATTAGCCAGGCGTGGCGGTGGG - Intronic
1015618858 6:135108181-135108203 AATTACCCAGACATGGTGGTGGG - Intergenic
1015670882 6:135688443-135688465 AATTAACCAGGCATGGAGGCAGG - Intergenic
1016080118 6:139845527-139845549 AATTAGCCGGACTTGGTGGTGGG - Intergenic
1016140792 6:140607369-140607391 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1016156099 6:140810240-140810262 AATTAGCCAGACCTGGTGGTGGG - Intergenic
1016179721 6:141130048-141130070 AATTAACCAGGCATGGTGGTAGG + Intergenic
1016294834 6:142563421-142563443 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1016360269 6:143260170-143260192 AATTAACCAGGCGTGGTGGTGGG - Intronic
1016552241 6:145294704-145294726 AATTACCCAGGCTTGGTGGTGGG + Intergenic
1017096232 6:150807818-150807840 AATTAACCAGGCATGGTGGTGGG + Intronic
1017274073 6:152545429-152545451 AATTAGCCAGACATGGTGGTGGG + Intronic
1017475775 6:154790657-154790679 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1017806833 6:157953504-157953526 AATTAGCCAGGCTTGGCGGTGGG - Intergenic
1017858661 6:158375092-158375114 AATTAGCCAGACGTGGTGGTGGG + Intronic
1017902104 6:158727318-158727340 AATTAGCCAGACGTGGTGGTGGG - Intronic
1018190967 6:161308659-161308681 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1018311432 6:162513658-162513680 CATAAACCAGACTTAGAGGATGG + Intronic
1018840125 6:167510446-167510468 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1019065874 6:169297228-169297250 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1019232571 6:170580564-170580586 AATTAGCCAGACGTGGTGGTAGG + Intronic
1019375531 7:689826-689848 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1019535719 7:1529011-1529033 ATTTAACCAGACGTGGTGGTGGG + Intergenic
1019850545 7:3552184-3552206 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1019974690 7:4571755-4571777 AATTAGCCAGACATGGTGGTGGG + Intergenic
1020140542 7:5609204-5609226 AATTAGCCAGACATGGTGGTGGG + Intergenic
1020234072 7:6341847-6341869 CATTACCCAGGCATGGTGGTGGG + Intronic
1020263082 7:6542151-6542173 AATTAGCCAGACGTGGTGGTGGG + Intronic
1020308218 7:6850786-6850808 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1020505888 7:8987282-8987304 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1021557493 7:21935858-21935880 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1021623472 7:22570469-22570491 AATTAGCCAGACGTGGTGGTGGG - Intronic
1021674841 7:23069614-23069636 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1021987910 7:26114925-26114947 AATTAACCAGGCTTAGTGGTGGG + Intergenic
1022460582 7:30601925-30601947 AATTAGCCAGACGTGGTGGTGGG - Intronic
1022715946 7:32898689-32898711 CATTAGCCAGACATGGTGGCGGG - Intergenic
1022964793 7:35462513-35462535 GATTTACCAGAGTTGCAGGTTGG - Intergenic
1023001461 7:35811976-35811998 AATTAGCCAGACATGGTGGTTGG + Intronic
1023483545 7:40660405-40660427 AATTAGCCAGACATGGTGGTGGG - Intronic
1023576711 7:41635778-41635800 TATTAGCCAGACATGGTGGTGGG - Intergenic
1023600598 7:41878121-41878143 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1023634358 7:42194913-42194935 AATTAGCCAGACCTGGTGGTGGG - Intronic
1023712226 7:43006982-43007004 AATTAACCAGTCATGGTGGTGGG - Intergenic
1025082193 7:55993428-55993450 AATTAGCCAGACGTGGTGGTGGG + Intronic
1025189370 7:56884960-56884982 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1025190442 7:56891890-56891912 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1025681498 7:63685030-63685052 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1025682570 7:63691957-63691979 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1025697075 7:63783448-63783470 AATTAGCCAGACATGGTGGTCGG + Intergenic
1025804255 7:64814615-64814637 AATTAACTAGACTTGGTGGTGGG + Intronic
1025931356 7:65997263-65997285 AATTAACCAGGCATGGTGGTGGG - Intergenic
1026149945 7:67779446-67779468 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1026551429 7:71372311-71372333 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1026591302 7:71697972-71697994 CATTAGCCAGGCATGGTGGTGGG + Intronic
1026614124 7:71886622-71886644 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1026743135 7:72991116-72991138 AATTAGCCGGACTTGGTGGTGGG + Intergenic
1026759875 7:73118664-73118686 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1026803001 7:73411569-73411591 AATTAGCCGGACTTGGTGGTGGG + Intergenic
1026894412 7:74001630-74001652 AATTAACCAGACGTGGTGGCGGG - Intergenic
1026958285 7:74392200-74392222 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1026961924 7:74414246-74414268 AATTAGCCAGACTTGGTGGTGGG + Intergenic
1026976793 7:74503598-74503620 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1026980352 7:74523068-74523090 CCTTAGCCAGACATGGTGGTAGG + Intronic
1027029249 7:74875820-74875842 AATTAGCCAGACTTGGTGGTGGG + Intergenic
1027036217 7:74927476-74927498 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1027087346 7:75273988-75274010 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1027100600 7:75373962-75373984 AATTAGCCGGACTTGGTGGTGGG - Intergenic
1028630806 7:92931787-92931809 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1028634962 7:92977483-92977505 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1029047099 7:97641019-97641041 CATTAGCCGGGCTTGGTGGTGGG + Intergenic
1029193715 7:98789672-98789694 AATTAACCAGGCATGGTGGTGGG - Intergenic
1029250230 7:99231094-99231116 AATTAGCCAGGCGTGGAGGTGGG - Intergenic
1029366212 7:100118202-100118224 AATTAACCAGACATGGTGGCGGG + Intronic
1029393652 7:100291957-100291979 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1029578934 7:101422161-101422183 AATTAGCCAGACGTGGTGGTGGG + Intronic
1029665179 7:101990523-101990545 AATTAGCCAGACATGGTGGTGGG - Intronic
1029752204 7:102549547-102549569 AATTAACCAGGCGTGGTGGTGGG - Intronic
1029770156 7:102648641-102648663 AATTAACCAGGCGTGGTGGTGGG - Intronic
1029797011 7:102907119-102907141 AATTAGCCAGACGTGGTGGTGGG - Intronic
1029840200 7:103354515-103354537 AATTAGCCAGACGTGGTGGTGGG - Intronic
1029998758 7:105035171-105035193 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1030412620 7:109200883-109200905 AATTAGCCAGACATGGTGGTGGG - Intergenic
1030894379 7:115039067-115039089 CATTAGCCGGGCTTGGTGGTGGG + Intergenic
1031015255 7:116568279-116568301 AATTAGCCAGACATGGTGGTGGG + Intergenic
1031312095 7:120211418-120211440 AATTAACCAGGCATGGTGGTGGG + Intergenic
1031381186 7:121087806-121087828 CATTAGCCAGGCATGGTGGTGGG - Intronic
1031465419 7:122104445-122104467 CATTAGCCAGGCTTGGTGGTGGG + Intronic
1031613045 7:123849447-123849469 AATTAGCCAGACGTGGTGGTGGG - Intronic
1032031320 7:128486143-128486165 AATTAACCAGGCGTGGTGGTGGG + Intronic
1032127311 7:129204495-129204517 AATTAGCCAGACATGGTGGTGGG + Intronic
1032362019 7:131264985-131265007 AATTAGCCAGACATGGTGGTGGG - Intronic
1032392609 7:131565795-131565817 CATTAACCAGGCGTGGTGGCGGG + Intergenic
1032411297 7:131694768-131694790 AATTAGCCAGACATGGTGGTGGG + Intergenic
1032775156 7:135105216-135105238 AATTAGCCAGACGTGGTGGTGGG - Intronic
1032819870 7:135514231-135514253 AATTAGCCAGACATGGTGGTGGG + Intergenic
1033209477 7:139450189-139450211 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1033235497 7:139634824-139634846 AATTAGCCAGACCTGGTGGTAGG - Intronic
1033253797 7:139781684-139781706 AATTAGCCAGACGTGGCGGTGGG + Intronic
1033377789 7:140780387-140780409 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1033417895 7:141180309-141180331 AATTAGCCAGGCTTGGAGGCGGG + Intronic
1033593707 7:142838190-142838212 AATTAACCAGTCGTGGTGGTGGG + Intergenic
1033788955 7:144768388-144768410 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1033895615 7:146065874-146065896 AATTACCCAGGCTTGGTGGTGGG + Intergenic
1034046457 7:147933712-147933734 AATTAACCAGGCATGGTGGTGGG + Intronic
1034167933 7:149039913-149039935 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1034428956 7:151030789-151030811 AATTAACCAGGCATGGTGGTGGG + Intronic
1034615993 7:152417265-152417287 AATTAGCCAGACATGGTGGTGGG - Intronic
1035243677 7:157548667-157548689 CATTCACTAGATTTGGGGGTGGG - Intronic
1035793698 8:2333309-2333331 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1035799104 8:2388397-2388419 CATTAGCCAGGCATGGTGGTGGG + Intergenic
1036187679 8:6638383-6638405 CATTAACCACACTTGGATGCTGG + Intronic
1036247754 8:7134131-7134153 AATTAACCAGGCATGGTGGTAGG - Intergenic
1036490726 8:9223022-9223044 AATTAGCCAGACATGGTGGTGGG - Intergenic
1036525517 8:9530876-9530898 AATTAGCCAGACTTGGTGGCGGG - Intergenic
1036631821 8:10521252-10521274 AATTAGCCAGACATGGTGGTGGG + Intergenic
1036978936 8:13446791-13446813 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1037240927 8:16776586-16776608 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1037386973 8:18353220-18353242 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1037823232 8:22145746-22145768 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1038409192 8:27345012-27345034 AATTAGCCAGACATGGTGGTGGG + Intronic
1038523198 8:28251119-28251141 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1038741049 8:30217241-30217263 CATTAGCCAGGCATGGTGGTTGG + Intergenic
1038748153 8:30272136-30272158 AATTAGCCAGGCTTGGTGGTAGG - Intergenic
1039034771 8:33348027-33348049 AATTAGCCAGACCTGGTGGTGGG + Intergenic
1039527307 8:38228363-38228385 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1039667661 8:39553263-39553285 AATTAACCAGGCATGGTGGTGGG + Intergenic
1039710002 8:40046140-40046162 AATTAGCCAGACATGGTGGTGGG + Intergenic
1040000399 8:42571049-42571071 AATTAGCCAGACATGGTGGTGGG - Intergenic
1040004141 8:42604286-42604308 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1040322552 8:46325953-46325975 AATTAACCAGGCATGGTGGTGGG + Intergenic
1040472419 8:47745358-47745380 AATTAGCCAGACATGGTGGTGGG + Intergenic
1040478544 8:47802799-47802821 AATTAACCAGGCATGGTGGTGGG - Intronic
1040550992 8:48437496-48437518 CATTAGCCAGGCGTGGTGGTGGG - Intergenic
1040663326 8:49600243-49600265 AATTAGCCAGACATGGTGGTGGG + Intergenic
1040829289 8:51660036-51660058 CATTAGCCCGACATGGTGGTGGG - Intronic
1040950257 8:52931582-52931604 AATTAGCCAGACATGGTGGTGGG - Intergenic
1041065519 8:54079123-54079145 AATTAGCCAGCCTTGGTGGTGGG - Intronic
1041105563 8:54440243-54440265 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1041248395 8:55911043-55911065 AATTAGCCGGACATGGAGGTGGG - Intronic
1041268880 8:56091302-56091324 CATTAACCATGCGTGGGGGTGGG + Intergenic
1041322937 8:56633574-56633596 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1042076954 8:65006896-65006918 CATAAGCTAGACTGGGAGGTGGG + Intergenic
1042125365 8:65532981-65533003 AATTAGCCAGACGTGGTGGTAGG + Intergenic
1042248390 8:66730824-66730846 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1042556324 8:70036320-70036342 AATTAACCAGGCATGGTGGTGGG + Intergenic
1042798603 8:72692085-72692107 AATTAGCCAGACGTGGTGGTGGG + Intronic
1042829652 8:73012522-73012544 AATTAGCCAGCCTTGGTGGTGGG + Intronic
1043443755 8:80299719-80299741 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1043608080 8:82027236-82027258 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1044057115 8:87584957-87584979 AATTAACCAGTCATGGTGGTGGG + Intronic
1044168092 8:89014320-89014342 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1044354880 8:91209278-91209300 AATTAGCCAGACATGGTGGTGGG + Intronic
1044590169 8:93906732-93906754 TATTAACCAGGCGTGGTGGTGGG - Intronic
1044644200 8:94420834-94420856 AATTAGCCAGACGTGGTGGTGGG + Intronic
1044770575 8:95626844-95626866 AATTAACCATACTTTGAGCTGGG + Intergenic
1045133295 8:99182883-99182905 AATTAGCCAGACATGGGGGTGGG - Intronic
1045187152 8:99850775-99850797 AATTAGCCAGGCTTGGTGGTAGG + Intronic
1045284417 8:100778128-100778150 AATTAGCCAGACATGGTGGTGGG - Intergenic
1045461117 8:102426668-102426690 CATTAGCCAGGCATGGTGGTGGG - Intergenic
1045471430 8:102515694-102515716 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1045762362 8:105625726-105625748 CATTAGCCAGGTTTGGTGGTGGG - Intronic
1045948579 8:107825945-107825967 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1046013473 8:108577775-108577797 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1046070832 8:109251319-109251341 AATTAACCAGGCGTGGTGGTGGG - Intronic
1046649854 8:116826018-116826040 AATTAGCCAGACGTGGTGGTGGG - Intronic
1047118856 8:121877379-121877401 AATTACCCAGGCTTGGTGGTGGG - Intergenic
1047467782 8:125135063-125135085 AATTAGCCAGACATGGAGGTTGG - Intronic
1047495461 8:125405641-125405663 CAGTAGCCAGACTTGGAGGCAGG - Intergenic
1047709043 8:127531921-127531943 CATTAGCCAGGCATGGTGGTAGG + Intergenic
1047745906 8:127844860-127844882 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1047916029 8:129584681-129584703 CATTAACCAGGCTGGGCGGGAGG - Intergenic
1047942202 8:129836855-129836877 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1047992932 8:130305510-130305532 AATTAGCCAGACATGGTGGTGGG - Intronic
1048211208 8:132455888-132455910 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1048463013 8:134638578-134638600 CATTAACCAGGCGTGGTGGCGGG + Intronic
1048484713 8:134836184-134836206 AATTAACCAGACATGGTGGCAGG - Intergenic
1048866408 8:138764811-138764833 CATTAGCCAGGCATGGTGGTGGG + Intronic
1049197129 8:141321942-141321964 AATTAGCCAGGCATGGAGGTGGG + Intergenic
1049699770 8:144005028-144005050 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1049740006 8:144234663-144234685 AATTAGCCAGACATGGTGGTGGG - Intronic
1050252246 9:3757263-3757285 AATTATCCAGACATGGTGGTGGG + Intergenic
1050659052 9:7863022-7863044 TATTACCCAGACGTGGTGGTGGG + Intronic
1050692159 9:8240423-8240445 AATTAGCCAGACCTGGTGGTGGG + Intergenic
1050751317 9:8941099-8941121 CATTTACCTGACTTGGTGGGAGG - Intronic
1051111088 9:13637651-13637673 AATTAGCCAGACTTGGTGGTGGG - Intergenic
1051386862 9:16518747-16518769 CATTAGCCAGGCATGGTGGTGGG - Intronic
1051438042 9:17053723-17053745 CATTAGCCAGGCTTGGTGGCAGG + Intergenic
1051649288 9:19304683-19304705 AATTAGCCAGACGTGGTGGTGGG - Intronic
1053236298 9:36457757-36457779 AATTAACCAGGCATGGTGGTGGG + Intronic
1053249128 9:36559922-36559944 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1053310365 9:37014516-37014538 CATAAACCTGACTTGGAGTTGGG - Intronic
1053506230 9:38645712-38645734 AATTATCCAGGCTTGGTGGTGGG - Intergenic
1053508315 9:38665700-38665722 AATTAGCCAGACGTGGTGGTAGG - Intergenic
1053515828 9:38729934-38729956 CATTAGCCAGACATGGTGGTGGG - Intergenic
1053796387 9:41730693-41730715 AATTAACCAGGCATGGTGGTGGG - Intergenic
1053837964 9:42160997-42161019 AATTAACCAGGCATGGTGGTGGG + Intergenic
1053882930 9:42613775-42613797 CATTAGCCAGACATGGTGGTGGG + Intergenic
1053883053 9:42615134-42615156 AATTAACCAGGCATGGTGGTGGG - Intergenic
1053889616 9:42679165-42679187 AATTAACCAGGCATGGTGGTGGG + Intergenic
1053889739 9:42680527-42680549 CATTAGCCAGACATGGTGGTGGG - Intergenic
1054184792 9:61942769-61942791 AATTAACCAGGCATGGTGGTGGG - Intergenic
1054221954 9:62421245-62421267 CATTAGCCAGACATGGTGGTGGG + Intergenic
1054222076 9:62422606-62422628 AATTAACCAGGCATGGTGGTGGG - Intergenic
1054228638 9:62486566-62486588 AATTAACCAGGCATGGTGGTGGG + Intergenic
1054228760 9:62487928-62487950 CATTAGCCAGACATGGTGGTGGG - Intergenic
1054653715 9:67645735-67645757 AATTAACCAGGCATGGTGGTGGG + Intergenic
1055139755 9:72862820-72862842 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1055173800 9:73292749-73292771 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1055367369 9:75559104-75559126 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1055477568 9:76678201-76678223 AATTAGCCAGACGTGGTGGTGGG + Intronic
1055519205 9:77063251-77063273 AATTAACCAGGCATGGTGGTGGG - Intergenic
1055612924 9:78041770-78041792 AATTAACCAGACATGGTGGCAGG + Intergenic
1056180810 9:84080488-84080510 AATTAGCCAGGCTTGGTGGTAGG - Intergenic
1056333877 9:85546275-85546297 AATTAACCAGGCATGGTGGTGGG - Intergenic
1056415200 9:86368790-86368812 AATTAACCAGGCATGGTGGTGGG - Intergenic
1056471549 9:86909331-86909353 CATTAAGCAGTCTTGAAAGTTGG - Intergenic
1056523213 9:87419117-87419139 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1056527298 9:87455209-87455231 TATTAGCCAGACATGGTGGTGGG + Intergenic
1056908199 9:90673153-90673175 AATTAGCCAGACATGGTGGTGGG - Intergenic
1057106254 9:92420387-92420409 GAGTAACCAGAGTTGGAGTTTGG - Intronic
1057609466 9:96527762-96527784 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1058200754 9:102036850-102036872 AATTAGCCAGACATGGTGGTGGG + Intergenic
1058391989 9:104505958-104505980 AATTAGCCAGACTTGGTGGTGGG - Intergenic
1058395039 9:104542274-104542296 TATTAGCCAGACATGGTGGTGGG - Intergenic
1058588171 9:106532633-106532655 CCTTCACCAGACTTGCAGGAGGG + Intergenic
1058658847 9:107250354-107250376 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1058892587 9:109373786-109373808 CATTCCCCAAAGTTGGAGGTGGG + Intergenic
1059108957 9:111536374-111536396 AATTAACCAGGCTTGGTGGTGGG + Intronic
1059388690 9:113985251-113985273 CAAGCACCAGACTTGGAAGTTGG - Intronic
1059576310 9:115492545-115492567 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1059961215 9:119566319-119566341 AGTTAACCAGGCTTGGTGGTGGG + Intergenic
1060067817 9:120519024-120519046 AATTAGCCAGGCGTGGAGGTGGG + Intronic
1060157568 9:121330424-121330446 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1060175079 9:121491756-121491778 AATTAGCTAGACTTGGTGGTGGG - Intergenic
1060489124 9:124069067-124069089 AATTAACCAGGCATGGTGGTGGG + Intergenic
1060591189 9:124817933-124817955 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1060780923 9:126412095-126412117 CATTGACCAGCCTTGGAGAGCGG + Intronic
1061028373 9:128065263-128065285 AATTACCCAGGCTTGGAGGTGGG - Intronic
1061189666 9:129074979-129075001 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1061342138 9:129991080-129991102 CATTAGCCAGGCGTGGTGGTGGG - Intronic
1061399113 9:130358820-130358842 AATTAGCCAGACGTGGTGGTGGG - Intronic
1061426622 9:130502704-130502726 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1061745503 9:132736634-132736656 CATTAGCCAGGCATGGTGGTGGG + Intronic
1203429104 Un_GL000195v1:73533-73555 CATTATCCAGGCATGGAGGCAGG + Intergenic
1203735113 Un_GL000216v2:130185-130207 AATTAGCCAGACGTGGTGGTGGG - Intergenic
1185516137 X:700401-700423 AATTAGCCAGACTTGGTGGTGGG - Intergenic
1185561631 X:1064363-1064385 AATTAGCCAGACATGGTGGTGGG + Intergenic
1185585206 X:1237877-1237899 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1185974743 X:4707547-4707569 AATTAGCCAGACATGGTGGTGGG + Intergenic
1186608157 X:11112335-11112357 CATTAGCCAGACGTGCTGGTGGG + Intronic
1186975151 X:14894463-14894485 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1187208008 X:17201263-17201285 CAACAACCAGGCTGGGAGGTGGG - Intergenic
1187295906 X:18000379-18000401 CATTAACAAGATCTGGTGGTAGG - Intergenic
1187437218 X:19283642-19283664 CATCAACAAGACAGGGAGGTGGG + Intergenic
1187449242 X:19382102-19382124 AATTAGCCAGACATGGTGGTGGG + Intronic
1187855497 X:23632792-23632814 AATTAGCCAGACATGGTGGTGGG + Intergenic
1187886440 X:23893281-23893303 CATTAGCCAGGCGTGGTGGTGGG + Intronic
1187935079 X:24328134-24328156 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1187937910 X:24353650-24353672 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1188372496 X:29386175-29386197 AATTAACCAGGTTTGGTGGTGGG - Intronic
1188458148 X:30390959-30390981 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1188692886 X:33152316-33152338 AATTAGCCAGTCTTGGTGGTGGG - Intronic
1189348472 X:40260116-40260138 CATTCACCTGCCTTTGAGGTAGG + Intergenic
1189594263 X:42547756-42547778 CAATACCCAGTATTGGAGGTGGG - Intergenic
1189986342 X:46556867-46556889 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1190073273 X:47296249-47296271 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1190231424 X:48585267-48585289 CATTAACCGGGCATGGTGGTGGG - Intergenic
1190464449 X:50712017-50712039 CAATAACCACCCTGGGAGGTAGG - Intronic
1190475486 X:50823018-50823040 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1190822736 X:53989109-53989131 AATTAGCCAGACATGGTGGTGGG - Intronic
1190837555 X:54114894-54114916 AATTAGCCAGACATGGTGGTGGG - Intronic
1190868254 X:54403022-54403044 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1191864327 X:65691651-65691673 AATTAACCAGGCGTGGAGGCGGG - Intronic
1192094387 X:68195282-68195304 CATCAACCAGTCTTTGAGGGTGG - Intronic
1192108942 X:68344461-68344483 AATTAGCCAGACATGGAGTTGGG + Intronic
1192999783 X:76551608-76551630 AATTAGCCAGACATGGTGGTGGG - Intergenic
1193102175 X:77626740-77626762 CAATAATGAGACTAGGAGGTAGG + Intronic
1193131229 X:77921755-77921777 AATTAGCCAGGCTTGGTGGTGGG + Intronic
1193201317 X:78694604-78694626 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1193387160 X:80885512-80885534 AATTAGCCAGACATGGTGGTGGG - Intergenic
1193731896 X:85112201-85112223 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1194315753 X:92375322-92375344 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1194896962 X:99454864-99454886 CATTAACCGGGCGTGGTGGTGGG - Intergenic
1195042096 X:101023994-101024016 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1195154439 X:102109276-102109298 AATTAACCAGGCTTGGTGGTGGG + Intergenic
1195373285 X:104201058-104201080 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1195628673 X:107031038-107031060 AATTAGCCAGACATGGTGGTGGG - Intergenic
1195692976 X:107644155-107644177 AATAAACCAGACTAGAAGGTAGG - Intronic
1195921214 X:109985705-109985727 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1196421274 X:115524307-115524329 AATTATCCAGGCTTGGTGGTGGG + Intergenic
1196798989 X:119525101-119525123 CATTAGCCAGGCGTGGTGGTGGG + Intergenic
1196888594 X:120270856-120270878 CACCAACCACACTTGGATGTAGG + Intronic
1196925276 X:120628089-120628111 AATTAGCCAGACGTGGTGGTGGG + Intronic
1197231990 X:124015134-124015156 AATTAGCCGGACTTGGTGGTTGG - Intronic
1198380189 X:136076419-136076441 AATTAGCCAGACATGGTGGTGGG - Intergenic
1198424349 X:136500401-136500423 CATTAACCAGGCCTAAAGGTTGG - Intronic
1199240491 X:145542913-145542935 AATTAACCAGACGTGGTGGCGGG - Intergenic
1199334102 X:146598650-146598672 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1199351363 X:146804894-146804916 AATTAACCAGGCGTGGTGGTGGG + Intergenic
1199352544 X:146819599-146819621 AATTAACCAGGCGTGGTGGTGGG - Intergenic
1199460484 X:148078356-148078378 AATTAGCCAGACGTGGTGGTGGG + Intergenic
1200157725 X:153986151-153986173 AATTAACCAGGCATGGTGGTGGG + Intergenic
1200245700 X:154523661-154523683 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1200623804 Y:5486896-5486918 AATTAGCCAGGCTTGGTGGTGGG - Intronic
1200820741 Y:7580331-7580353 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1201057706 Y:10012142-10012164 GATTAACCAGGCTTGGTGGTGGG - Intergenic
1201350369 Y:13033871-13033893 AATTAGCCAGGCTTGGTGGTGGG + Intergenic
1201861357 Y:18600821-18600843 CATTAACCAGGCATGGTGGCAGG + Intergenic
1201871966 Y:18719559-18719581 CATTAACCAGGCATGGTGGCAGG - Intergenic
1202093573 Y:21219939-21219961 AATTAGCCAGACCTGGTGGTGGG + Intergenic
1202102882 Y:21329238-21329260 AATTAGCCAGCCTTGGTGGTGGG + Intergenic
1202189175 Y:22223436-22223458 AATTAGCCACACTTGGTGGTGGG + Intergenic
1202239565 Y:22752411-22752433 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1202392552 Y:24386173-24386195 AATTAGCCAGGCTTGGTGGTGGG - Intergenic
1202478232 Y:25283944-25283966 AATTAGCCAGGCTTGGTGGTGGG + Intergenic