ID: 1144037098

View in Genome Browser
Species Human (GRCh38)
Location 17:11376866-11376888
Sequence AAATCCGGGATTCTGGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144037094_1144037098 -10 Left 1144037094 17:11376853-11376875 CCTCTGACCTACTAAATCCGGGA 0: 1
1: 0
2: 0
3: 9
4: 90
Right 1144037098 17:11376866-11376888 AAATCCGGGATTCTGGAGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 146
1144037091_1144037098 -5 Left 1144037091 17:11376848-11376870 CCTCTCCTCTGACCTACTAAATC 0: 1
1: 0
2: 5
3: 85
4: 535
Right 1144037098 17:11376866-11376888 AAATCCGGGATTCTGGAGCCGGG 0: 1
1: 0
2: 1
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144037098 Original CRISPR AAATCCGGGATTCTGGAGCC GGG Intronic
900326194 1:2109839-2109861 AAAGCCGTCATCCTGGAGCCGGG + Intronic
903015940 1:20361883-20361905 AAACCCCAGATTCTGAAGCCAGG - Intergenic
903805074 1:25999423-25999445 AAAGCAGGGACTCTGGACCCTGG - Intergenic
904993326 1:34611728-34611750 AAATCGCGTAGTCTGGAGCCAGG - Intergenic
905461341 1:38124850-38124872 AAATCAGGACCTCTGGAGCCAGG + Intergenic
907685592 1:56608422-56608444 AAATCTGGGATTCTGAAACATGG + Intronic
908153933 1:61333440-61333462 AAATCCAGGATTTTGGGACCAGG - Intronic
911057351 1:93720358-93720380 AGATCCTGGACTCTGGAGGCTGG + Intronic
911432880 1:97814692-97814714 AAATCCAGGAATCTCCAGCCTGG + Intronic
913693041 1:121297701-121297723 AAATCCAGGATTGTGAACCCAGG - Intronic
914141246 1:144950778-144950800 AAATGTTGGATTCTAGAGCCAGG + Intronic
914144515 1:144982380-144982402 AAATCCAGGATTGTGAACCCAGG + Intronic
915316697 1:155032878-155032900 GAAGCCTGGATTCTGGGGCCTGG + Intronic
916079784 1:161225255-161225277 AAATCTAGGAATATGGAGCCTGG - Intergenic
919167601 1:193915689-193915711 AATTCCTGGATTATGGAACCAGG + Intergenic
920480363 1:206316070-206316092 AAATCCAGGATTGTGAACCCAGG - Intronic
920538634 1:206759933-206759955 AAATCCGTGTAGCTGGAGCCAGG + Intergenic
920948191 1:210549008-210549030 AGAACATGGATTCTGGAGCCTGG + Intronic
921964715 1:221076075-221076097 AAAGCTGGCATTCTGTAGCCTGG - Intergenic
922453423 1:225755021-225755043 AGAGCCTGGACTCTGGAGCCCGG + Intergenic
923417307 1:233775974-233775996 GAATTCTGGAGTCTGGAGCCTGG + Intergenic
1065483707 10:26217181-26217203 AGATCCGGGTGTCTGGACCCTGG + Intronic
1065791764 10:29266853-29266875 AAATCGATGATTCGGGAGCCTGG - Intergenic
1065816613 10:29488300-29488322 AAAGCTGGGATTCTGGAGTGGGG + Intronic
1065956249 10:30696356-30696378 AAAGCTGGGATTCTGGAGTGGGG - Intergenic
1067562474 10:47313711-47313733 AAGCCTGGGTTTCTGGAGCCTGG - Intergenic
1069861422 10:71474067-71474089 ACATCCTGGACTCTGGAGCCTGG - Intronic
1069900000 10:71701751-71701773 AAACCCTGGATTTTGGAGACTGG - Intronic
1071724692 10:88186201-88186223 AAATAAGGGATTCTGGCGCTGGG + Intergenic
1072234751 10:93443935-93443957 AAAGTTGGGATTCTGGAGCCAGG - Intronic
1079326585 11:19498097-19498119 AGAGCCTGGAGTCTGGAGCCAGG - Intronic
1079532164 11:21467143-21467165 AAAGCAAGGATTCTGGAGTCAGG + Intronic
1080043431 11:27783645-27783667 AAATCTGTAATTCTAGAGCCAGG - Intergenic
1080618075 11:33962208-33962230 AAAGCCAGGAATCAGGAGCCAGG + Intergenic
1084461090 11:69297037-69297059 AAACCAGGGACCCTGGAGCCTGG - Exonic
1085477333 11:76796638-76796660 ACACCCGGGATTCTGCTGCCAGG + Exonic
1085645695 11:78221017-78221039 AAATGCGGGCTTGTGCAGCCTGG - Intronic
1088609718 11:111565455-111565477 AAATCCTGGGTTCTGGAATCAGG + Intergenic
1089348650 11:117808534-117808556 AGATCCCGGATTCTGTAGTCTGG - Intronic
1094487431 12:30936135-30936157 AAATCCTGAAATCTTGAGCCTGG + Intronic
1099786156 12:87266590-87266612 AAATCCTTGATTGTGAAGCCTGG + Intergenic
1100217966 12:92472529-92472551 ATATTCTGGATTCTGGGGCCTGG + Intergenic
1106749301 13:32743212-32743234 AACTACTGGACTCTGGAGCCTGG + Intronic
1113607054 13:111616318-111616340 ATATCTGTGATTCTGGAGCCAGG + Intronic
1118743116 14:68755562-68755584 AAATCATGGACTCTGGAGCTAGG - Intergenic
1119449178 14:74693710-74693732 AAAGCAGGGATTCTGGGTCCAGG - Intronic
1119741564 14:77017089-77017111 CAATCAGGGATTCTGGAGCAGGG - Intergenic
1120318369 14:82927091-82927113 AATTCCTGGGTTATGGAGCCTGG - Intergenic
1120994160 14:90402837-90402859 AAACACAGGATTCTGTAGCCTGG - Intronic
1121071998 14:91032333-91032355 ATAACAGGGAGTCTGGAGCCAGG - Intronic
1126076055 15:44910965-44910987 AAATTAGGGGTTCTGGGGCCAGG + Intergenic
1127626132 15:60781836-60781858 AAATCCCAGATTTTGGAGTCTGG + Intronic
1127733311 15:61819648-61819670 AAATCCGGGATCCTGAAAGCCGG - Intergenic
1128245871 15:66132423-66132445 AAATCTTGGACGCTGGAGCCTGG + Intronic
1128454605 15:67825510-67825532 AAGTCCGGGCTTCAGGACCCGGG + Intronic
1128771807 15:70288442-70288464 AAATACGGGCTCCAGGAGCCCGG - Intergenic
1130971355 15:88736257-88736279 ACATCCAGGAATCTGGAGACAGG + Intergenic
1132403544 15:101528633-101528655 CAAACCGTGATTCTGGAGCAGGG - Intergenic
1134134419 16:11669434-11669456 AAATGCGGGATTTTGGATGCAGG + Intronic
1135055479 16:19228446-19228468 AAATCAGGGATTCTCAACCCTGG + Intronic
1138954837 16:61958598-61958620 AAATCTGTGATTCTCCAGCCAGG - Intronic
1141220120 16:82061494-82061516 ATAACCTGGATTCTGGAGCTGGG - Intronic
1143245803 17:5484991-5485013 AAAGCAGTGATTCTGCAGCCTGG - Intronic
1143461881 17:7109164-7109186 AAAGCCCGGATCCTGGAGCTGGG + Intronic
1144037098 17:11376866-11376888 AAATCCGGGATTCTGGAGCCGGG + Intronic
1146295373 17:31645687-31645709 AAACATGGGATGCTGGAGCCTGG + Intergenic
1147927093 17:43952873-43952895 GAATCCGGGTTTCTGGGGTCGGG + Exonic
1148360229 17:47005726-47005748 AAATGGGGGATTCTGGAGTCTGG + Intronic
1148444787 17:47730975-47730997 AAATCGGGGATTGAGGAACCAGG + Intergenic
1148825751 17:50392673-50392695 AACTCAGGGACTCTGGAGCACGG - Intronic
1150068811 17:62135007-62135029 AAATCCATGATCCTTGAGCCAGG - Intergenic
1150163775 17:62921999-62922021 AATTACGGCATTCTGGTGCCAGG + Intergenic
1150508244 17:65720962-65720984 AAAGCATGGATTCTGGAACCAGG - Intronic
1150786488 17:68167329-68167351 ACATGGGGGATTCTGGAGTCCGG - Intergenic
1155054772 18:22173011-22173033 AACTCAGGGATCCTGGAGCTGGG + Intronic
1160739084 19:677613-677635 ATTTCCAGGGTTCTGGAGCCAGG + Intronic
1160740381 19:682874-682896 ACATCCGGAGTCCTGGAGCCGGG + Exonic
1162161512 19:8721326-8721348 AAACCCAAGATGCTGGAGCCTGG + Intergenic
1162424313 19:10584852-10584874 ACAGCAGGGATTCTGGACCCAGG - Intronic
1167337510 19:48896062-48896084 AAACCCGGGATTGCGGAGACGGG - Intronic
926090790 2:10047907-10047929 AAAGCCGGCAATCTGGAGTCTGG - Exonic
927904120 2:26845208-26845230 AGATCCGGCCTTCTGGAGGCTGG + Intergenic
933077357 2:77945876-77945898 CAATCCTGGACCCTGGAGCCAGG - Intergenic
934046088 2:88173504-88173526 AATTCTGGGATTCTAGAGTCAGG - Intronic
941595308 2:167469182-167469204 AAATTATGGACTCTGGAGCCAGG + Intergenic
945223966 2:207512858-207512880 AAATCTGGGATTCTGCAGAGAGG + Intergenic
946166231 2:217865731-217865753 AGGTCCAGTATTCTGGAGCCAGG + Intronic
1172194975 20:33085473-33085495 AAATCTGGGAGGCTGGAGTCAGG + Intronic
1172942854 20:38666406-38666428 AAATGGGGGAGCCTGGAGCCAGG - Intergenic
1173037389 20:39425616-39425638 AAATCAGAAATTCTGGAGTCAGG + Intergenic
1174172539 20:48626410-48626432 AAAGCTGGGATTCTGAACCCAGG - Intronic
1174385485 20:50186471-50186493 AGATCCAGGATTTTGGAGACGGG - Intergenic
1174911411 20:54611890-54611912 CAATCCGGGATTTTAGAGCCGGG + Intronic
1175219618 20:57409402-57409424 AAATCCTGGGTTCCTGAGCCAGG - Intergenic
1175501063 20:59451209-59451231 AAAGCAGGGATTTTTGAGCCAGG - Intergenic
1176157375 20:63628307-63628329 GAATCCGGGATCCTGCAGACAGG - Intergenic
1180988090 22:19917395-19917417 AAATCCAGGAAAGTGGAGCCAGG - Intronic
1185045798 22:48528184-48528206 AAACCCGTGAATCAGGAGCCTGG + Intronic
1185296248 22:50056759-50056781 AAATCAGGGACTCTGGGGGCAGG - Intronic
950287516 3:11756568-11756590 AAATCCGGTCTTCTGGGGCCAGG + Intergenic
953056956 3:39395728-39395750 AAACCCTGGATCCTGGATCCAGG - Intronic
954208352 3:49077617-49077639 AAAGCATGGACTCTGGAGCCAGG + Intronic
955751544 3:62189402-62189424 AAATACGGGAGTCTGGTTCCTGG + Intronic
956491453 3:69776386-69776408 AAGTCCAGGATTCAGAAGCCAGG - Intronic
958855027 3:99374919-99374941 AAGTCAGAGATTTTGGAGCCAGG - Intergenic
959097408 3:101971148-101971170 CAATCTGGGATGCTGGAGCTTGG - Intergenic
960796002 3:121488682-121488704 AAATCGGGCTTTCTGGAGTCAGG + Exonic
962661360 3:137603755-137603777 AAAACATGGACTCTGGAGCCAGG + Intergenic
965999588 3:174931280-174931302 AGATCATGGGTTCTGGAGCCAGG + Intronic
967105051 3:186249004-186249026 AGGTCCGGGGTTCTGGAGCGTGG - Intronic
969048841 4:4358251-4358273 AGAGCAAGGATTCTGGAGCCAGG + Intronic
970123759 4:12786682-12786704 AAATCTGCGAATCTGGACCCCGG + Intergenic
971938525 4:33185981-33186003 AAATGTAGAATTCTGGAGCCTGG - Intergenic
974651167 4:64755489-64755511 AAATCCACCATTCTGGGGCCTGG - Intergenic
977205918 4:94164938-94164960 AAAGCCAGGCATCTGGAGCCAGG - Intergenic
986395025 5:7320901-7320923 AAAACCAGAATTCTGGAACCAGG - Intergenic
988962981 5:36387908-36387930 AAATCCAGGATGCTGGAGCCAGG - Intergenic
997234834 5:132266760-132266782 CAATCCTGGATTCTGGACCAAGG + Intronic
999191402 5:149750180-149750202 AAATCAGGGATTCTCTTGCCTGG - Intronic
1000730392 5:164828028-164828050 AAATCAGGGATTCTGTCTCCTGG + Intergenic
1001124978 5:169011177-169011199 ATTTCTGGGATGCTGGAGCCTGG - Intronic
1001310969 5:170610539-170610561 GAAGCCAGGACTCTGGAGCCAGG + Intronic
1007112682 6:39322158-39322180 TAATCCTGGATTCTGGCCCCAGG - Intronic
1013662861 6:112316296-112316318 GAATCAGGGGTTCTGGAGTCAGG - Intergenic
1017471404 6:154740391-154740413 AAATCAGTGATTCTGGACCAGGG - Intronic
1019291000 7:250243-250265 AAATCATGGATTCGGGGGCCGGG - Intronic
1020485873 7:8719685-8719707 AGAGCCTAGATTCTGGAGCCAGG - Intronic
1023146234 7:37153552-37153574 CAACCTGGGATGCTGGAGCCTGG + Intronic
1024406666 7:48989976-48989998 AAGTCCTGGAATCTGAAGCCCGG + Intergenic
1033199769 7:139359144-139359166 GAAGCCTGGATTCTGAAGCCCGG - Intronic
1036725565 8:11217789-11217811 AGAGCCAGGATTCTGGAGCCAGG + Intergenic
1039576594 8:38628646-38628668 ATAGCAGGGATTCTGGAGGCAGG - Intergenic
1040993360 8:53375833-53375855 TATTCCAGGATTCTGCAGCCTGG - Intergenic
1046118686 8:109817569-109817591 AGAGCAGGGATTCTAGAGCCAGG + Intergenic
1047090529 8:121569875-121569897 AAATCAGTGATTTTGGAGGCAGG - Intergenic
1047929671 8:129714067-129714089 AAACCCGGGATGCTGCAGACAGG + Intergenic
1048593316 8:135841664-135841686 AGATCATGAATTCTGGAGCCAGG + Intergenic
1049547216 8:143238597-143238619 AAAACAGAGATTCTGGACCCCGG + Intergenic
1051866131 9:21684988-21685010 AAGTCCAGGTTTGTGGAGCCTGG - Intergenic
1057007077 9:91569817-91569839 AAATTCTGGCTTCTGGAGGCTGG - Intronic
1058381178 9:104378760-104378782 CAATCCTGGATTCTGAAGCATGG + Intergenic
1059760880 9:117336403-117336425 AAGTCAGGGCTTCTGGGGCCTGG + Intronic
1060315296 9:122504247-122504269 AAAGCAGTGTTTCTGGAGCCAGG - Intergenic
1060548876 9:124475991-124476013 AAACCCGGGCTTCTGGGGCCTGG + Intronic
1060723633 9:125994025-125994047 ACATGGGAGATTCTGGAGCCTGG + Intergenic
1060813313 9:126622259-126622281 AAAACCCGGTTCCTGGAGCCTGG + Intronic
1060872712 9:127055682-127055704 AGAGCATGGATTCTGGAGCCAGG - Intronic
1061416665 9:130450937-130450959 AAATGCGGGATGCTGGGGCCAGG + Intronic
1062426530 9:136508653-136508675 AATCCCAGGTTTCTGGAGCCGGG - Intronic
1186123968 X:6392737-6392759 AAATCCAGGTTCCTGGAGCCTGG + Intergenic
1186218453 X:7324931-7324953 AATTCCTGGAGCCTGGAGCCTGG - Intronic
1186997635 X:15140705-15140727 AAAGCCTGGAACCTGGAGCCTGG + Intergenic
1189217785 X:39342021-39342043 AAATTATGGACTCTGGAGCCAGG + Intergenic
1189566189 X:42243581-42243603 AAATCAGAGACTCTGGAGCATGG + Intergenic
1190275468 X:48896600-48896622 AAATCCCAGATACAGGAGCCAGG + Intronic
1190277133 X:48906079-48906101 AGAGCCTGGATTCTGGGGCCAGG - Intronic
1190329215 X:49225524-49225546 AGAGCCTGGATTCTGGAGCCAGG + Intronic
1191947753 X:66554079-66554101 CAATCTGGGATGCTGGAGCTTGG + Intergenic
1195933787 X:110106355-110106377 AAAAGCTGGATTCTGGTGCCAGG - Intronic
1198655088 X:138905132-138905154 AAATCTGGGATTCTTGGGACAGG + Intronic