ID: 1144037616

View in Genome Browser
Species Human (GRCh38)
Location 17:11381681-11381703
Sequence TCACCTTCATGTGGCTCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 192}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144037616_1144037623 17 Left 1144037616 17:11381681-11381703 CCATCAGAGCCACATGAAGGTGA 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1144037623 17:11381721-11381743 TTCTTTCAGTCACTGCTGCTGGG 0: 1
1: 0
2: 3
3: 16
4: 369
1144037616_1144037624 18 Left 1144037616 17:11381681-11381703 CCATCAGAGCCACATGAAGGTGA 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1144037624 17:11381722-11381744 TCTTTCAGTCACTGCTGCTGGGG 0: 1
1: 0
2: 2
3: 31
4: 361
1144037616_1144037626 27 Left 1144037616 17:11381681-11381703 CCATCAGAGCCACATGAAGGTGA 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1144037626 17:11381731-11381753 CACTGCTGCTGGGGGCATCCAGG 0: 1
1: 0
2: 1
3: 25
4: 278
1144037616_1144037625 19 Left 1144037616 17:11381681-11381703 CCATCAGAGCCACATGAAGGTGA 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1144037625 17:11381723-11381745 CTTTCAGTCACTGCTGCTGGGGG 0: 1
1: 0
2: 1
3: 25
4: 266
1144037616_1144037622 16 Left 1144037616 17:11381681-11381703 CCATCAGAGCCACATGAAGGTGA 0: 1
1: 0
2: 1
3: 19
4: 192
Right 1144037622 17:11381720-11381742 GTTCTTTCAGTCACTGCTGCTGG 0: 1
1: 0
2: 0
3: 18
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144037616 Original CRISPR TCACCTTCATGTGGCTCTGA TGG (reversed) Intronic