ID: 1144037709

View in Genome Browser
Species Human (GRCh38)
Location 17:11382320-11382342
Sequence CTTTGGGAGGGGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146411
Summary {0: 1, 1: 14, 2: 1699, 3: 31018, 4: 113679}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144037709_1144037716 -8 Left 1144037709 17:11382320-11382342 CCTTCCACCTTCCCCTCCCAAAG 0: 1
1: 14
2: 1699
3: 31018
4: 113679
Right 1144037716 17:11382335-11382357 TCCCAAAGTGCTGAGTTTATGGG 0: 14
1: 2298
2: 49333
3: 340688
4: 241398
1144037709_1144037715 -9 Left 1144037709 17:11382320-11382342 CCTTCCACCTTCCCCTCCCAAAG 0: 1
1: 14
2: 1699
3: 31018
4: 113679
Right 1144037715 17:11382334-11382356 CTCCCAAAGTGCTGAGTTTATGG 0: 3
1: 315
2: 4837
3: 5080
4: 5471
1144037709_1144037719 11 Left 1144037709 17:11382320-11382342 CCTTCCACCTTCCCCTCCCAAAG 0: 1
1: 14
2: 1699
3: 31018
4: 113679
Right 1144037719 17:11382354-11382376 TGGGATTGAGTCACTACATCTGG 0: 1
1: 0
2: 0
3: 25
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144037709 Original CRISPR CTTTGGGAGGGGAAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr