ID: 1144038273

View in Genome Browser
Species Human (GRCh38)
Location 17:11386699-11386721
Sequence CTCAGGCGGGGCGCTGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 407
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 375}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144038273 Original CRISPR CTCAGGCGGGGCGCTGGCCT TGG Intronic
900147055 1:1162985-1163007 CTCAGGCGAGGCCCTGGCACAGG - Intergenic
900205805 1:1431460-1431482 CTCAGGGTGGGGGCGGGCCTGGG - Intergenic
900288602 1:1914334-1914356 CCCAGGATGGGCCCTGGCCTGGG + Intergenic
900946828 1:5835500-5835522 CCCAGGCTGGGCACAGGCCTGGG - Intergenic
900952467 1:5865638-5865660 CTCCTGCGTGGCGCTGCCCTTGG - Intronic
901436232 1:9248880-9248902 CTCAGCCAGGGCGCTGGCCGTGG + Intronic
901525660 1:9821364-9821386 CTCAGGTGATCCGCTGGCCTCGG + Intronic
901772770 1:11539022-11539044 CACAGGCTGGGCTCTGACCTGGG + Intergenic
902345674 1:15815262-15815284 CTCAGGTGAGCCACTGGCCTCGG + Intergenic
902428993 1:16347619-16347641 CTCAGGTGATCCGCTGGCCTTGG - Intronic
902950758 1:19881376-19881398 CTCAGGCGATCCCCTGGCCTCGG + Intergenic
903601193 1:24542009-24542031 CTCAGGCGGTCCACTTGCCTTGG + Intergenic
903732260 1:25505323-25505345 CTCAGGGTGGGCCCTGGCCATGG - Intergenic
904832157 1:33312177-33312199 TTCAGGCCGGGCCCTGGCCAGGG + Exonic
905174053 1:36125286-36125308 GCCGGGCGGGGCGCGGGCCTTGG - Intergenic
906099941 1:43253730-43253752 CTCAGGAGAGGGGCTGGGCTGGG + Intronic
906608767 1:47188237-47188259 CTCAGGCGAGCCTCTGGCCTTGG + Intronic
907197682 1:52699873-52699895 CTCAGGTGGTCCGCTGGCCTCGG + Intergenic
907204824 1:52760207-52760229 CTCAGGCGGATCGCCTGCCTTGG - Intronic
908750336 1:67416244-67416266 CTCAAGCGATCCGCTGGCCTTGG + Intronic
909652942 1:77996250-77996272 CTCAGGCAGGGGGATGGCTTGGG - Intronic
910935124 1:92480932-92480954 CTGGAGCGTGGCGCTGGCCTGGG - Exonic
911594619 1:99786252-99786274 CTCAGGCGATCCGCTTGCCTTGG - Intergenic
911638984 1:100266763-100266785 CTCTGCCTGGGCGGTGGCCTGGG + Intronic
912068716 1:105779966-105779988 CACAGGGGTGGCGCTGCCCTAGG + Intergenic
912514680 1:110210438-110210460 TCCGGGCGGGGCGCCGGCCTTGG - Intergenic
912708776 1:111934537-111934559 GTCTGGCGGGGCGCTGGTCTGGG - Intronic
914858318 1:151367898-151367920 CTCAAGCGATCCGCTGGCCTCGG + Intronic
915246269 1:154558429-154558451 CTCAGGCAGGGCCCCGGCCCCGG + Exonic
915382114 1:155451524-155451546 CTCAGGTGATCCGCTGGCCTTGG - Intronic
916464953 1:165064552-165064574 ATCAGGCGGAGTTCTGGCCTTGG - Intergenic
917954127 1:180075351-180075373 CTCAGGCGATCCTCTGGCCTTGG - Intronic
918240217 1:182614427-182614449 CTCAGGCGGTCCGCTCGCCTCGG - Intergenic
918490646 1:185078010-185078032 CTCAGGTGATCCGCTGGCCTTGG - Intronic
919248961 1:195028439-195028461 CTCAGGTGGTCCTCTGGCCTCGG + Intergenic
919261072 1:195194755-195194777 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
919747781 1:201019542-201019564 GTGAGGCGGGGCCCAGGCCTGGG - Intronic
920036199 1:203067462-203067484 CTCAGTCAGGGAGCGGGCCTGGG - Intronic
920660516 1:207910834-207910856 CCCAGGTGAGGCGCTGGCCCCGG + Intronic
921034315 1:211361928-211361950 CTCAGGCGATGCGCCTGCCTCGG + Intronic
921653188 1:217703403-217703425 CTCAGGTGATCCGCTGGCCTTGG + Intronic
923506554 1:234610025-234610047 CTCGGGCGCGGCGCGGGCCCCGG + Intergenic
923539154 1:234875934-234875956 CTCAGGAGGGGCGCTGATCTCGG - Intergenic
923601063 1:235403441-235403463 CTCAGGCAGTCCACTGGCCTCGG + Intronic
924439208 1:244072647-244072669 CCCAGGAGCAGCGCTGGCCTTGG + Intergenic
1062957881 10:1552184-1552206 CCCATGGGGGGAGCTGGCCTGGG + Intronic
1062971555 10:1652945-1652967 CTCAGGGAGGACACTGGCCTTGG - Intronic
1063151013 10:3336356-3336378 TTCAGGCAGGGACCTGGCCTCGG + Intergenic
1063443033 10:6088997-6089019 CGCAGGCGGGGCGCAGGCGCGGG + Intronic
1063611346 10:7564098-7564120 CTCAGGCTGGGCGCTGGGCAGGG + Intronic
1064746981 10:18488040-18488062 CTCAGGTGGTCCGCTTGCCTCGG + Intronic
1065006489 10:21385096-21385118 CTCAGGCGATCCGCTCGCCTTGG - Intergenic
1067068214 10:43115345-43115367 CTCAGGCTGGGAGGTGGCCTGGG + Intronic
1067573241 10:47386815-47386837 CTCAGGAGATCCGCTGGCCTTGG + Intergenic
1068353685 10:55882767-55882789 CTCAGGTGGCCCACTGGCCTCGG - Intergenic
1068964068 10:62894362-62894384 CTCAGGCGTGGAGCTGGGCCGGG - Intronic
1069497480 10:68918658-68918680 CTCAGGTGATCCGCTGGCCTTGG + Intronic
1070865629 10:79706600-79706622 ATCTGGCGGGGCCTTGGCCTGGG - Exonic
1070879422 10:79844731-79844753 ATCTGGCGGGGCCTTGGCCTGGG - Exonic
1070917642 10:80165122-80165144 ATCAGGCAGGGCGATGGCCCGGG - Intronic
1071563894 10:86661880-86661902 CTCAGGCCTGCCACTGGCCTTGG - Intronic
1071632532 10:87228821-87228843 ATCTGGCGGGGCCTTGGCCTGGG - Exonic
1071645981 10:87361039-87361061 ATCTGGCGGGGCCTTGGCCTGGG - Exonic
1073138052 10:101230347-101230369 CTCAAGCCGGGCGCTGGGCTAGG - Intergenic
1074877169 10:117622474-117622496 CTCAGGTGAGGCGCAGGCATGGG - Intergenic
1074993497 10:118733776-118733798 CTCAGGCGGTGCTCTCGCCTCGG - Intronic
1076891684 10:133287926-133287948 CTCTGGAGGGGCGCGGGTCTCGG - Intronic
1077005836 11:355777-355799 CTCAGGCAGGGAGGTGGCCAAGG + Intergenic
1077059020 11:609703-609725 CTCACGGGGGGCTCTGTCCTCGG - Exonic
1077059049 11:609783-609805 CTCACGGGGGGCTCTGTCCTCGG - Intronic
1077059063 11:609823-609845 CTCACGGGGGGCTCTGTCCTCGG - Intronic
1077128152 11:953696-953718 CTCAGTAGGGGCGCTGGGCCAGG + Intronic
1077186383 11:1237160-1237182 CCCAGGTGGGGCTCTGGTCTTGG + Exonic
1077578126 11:3399660-3399682 TTCAGAAGGGGCACTGGCCTAGG - Intergenic
1078233439 11:9462638-9462660 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1078599824 11:12720047-12720069 CTGAGGTGGAGCTCTGGCCTTGG + Intronic
1080388632 11:31825069-31825091 CTGACGCGCAGCGCTGGCCTGGG + Intronic
1083138248 11:60700310-60700332 CTCAGGCGATCCGCTTGCCTCGG - Intronic
1083340295 11:61954964-61954986 CTCAGGAGGGGCCCTGGGCTGGG + Intronic
1083399651 11:62414882-62414904 CTCAGGAGGGGACCTGGCCATGG - Intronic
1083655759 11:64228735-64228757 CTCAGGTGATCCGCTGGCCTTGG - Intronic
1084061712 11:66679516-66679538 CTCAAGCGATCCGCTGGCCTTGG + Intergenic
1084084363 11:66848102-66848124 CTGAGGTGGGACGCTGGCCTTGG + Intergenic
1084185290 11:67468111-67468133 CTCAGGGGGGTTGCTGGGCTGGG + Intronic
1084650519 11:70486789-70486811 CTCACCCGGAGCACTGGCCTCGG + Intronic
1084779321 11:71398114-71398136 CTCCGCCGGGGTGCTGGCCAGGG - Intergenic
1087045754 11:93842643-93842665 CCCAGGCTGGCCGCTGGCCCAGG - Intronic
1087660643 11:100983903-100983925 CTCAGGCGGTCCACTCGCCTTGG - Intronic
1088644998 11:111911033-111911055 CTACGACAGGGCGCTGGCCTGGG - Intronic
1089363990 11:117909915-117909937 CGTGGGAGGGGCGCTGGCCTCGG - Exonic
1089685975 11:120147119-120147141 CTCAGGCAGGGCAGTGACCTAGG - Intronic
1090662022 11:128889717-128889739 CTGAGGAGGGGCTCTGTCCTGGG - Intergenic
1090832317 11:130428172-130428194 CGCAGCCGGGGGGCAGGCCTCGG - Exonic
1091173556 11:133540119-133540141 ATCAGGCAAGGAGCTGGCCTTGG + Intergenic
1091394128 12:143197-143219 CTGAGGAGGGGAGCTGGGCTGGG + Intronic
1092373350 12:7935218-7935240 CTCAGGCGATCCGCCGGCCTCGG - Intronic
1093091207 12:14922840-14922862 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1093761392 12:22915411-22915433 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
1094219124 12:27974510-27974532 CTCAGTCCGGGTGCTGCCCTGGG - Intergenic
1096369685 12:51058653-51058675 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1096617913 12:52844682-52844704 CACAGACGTGTCGCTGGCCTGGG + Exonic
1097222678 12:57460179-57460201 CTCTGTCTGGGCGCTGGGCTCGG - Exonic
1098255173 12:68609345-68609367 CTCAGGTGATGCGCTCGCCTGGG - Intergenic
1102854386 12:116280134-116280156 CTCAAGCGATCCGCTGGCCTTGG - Intergenic
1103970191 12:124665904-124665926 CTCAGGCGAGCCTCTCGCCTCGG + Intergenic
1103991627 12:124803236-124803258 CTCAGTCAGGGTGCTGGCCACGG + Intronic
1104021240 12:124993805-124993827 CTCAGGCGGGCCCCTGGCCCGGG + Exonic
1104399280 12:128462338-128462360 CTCAGGGGATCCGCTGGCCTCGG + Intronic
1104913531 12:132251941-132251963 GGCAGGCGGGGGGCAGGCCTGGG - Intronic
1105354040 13:19641727-19641749 CTCAGGTGATGCGCTTGCCTCGG + Intronic
1105557244 13:21459011-21459033 CTGCGGCGGGGCGCGGGCCGCGG - Intronic
1106169031 13:27272831-27272853 CTCAGGCAGGGAGTTTGCCTGGG + Intronic
1106435607 13:29720865-29720887 CTCAGGGGGGCCCCAGGCCTTGG - Intergenic
1106603572 13:31208152-31208174 CTCAGGCAGGGCCCCGGCCCGGG + Intronic
1109393292 13:61721304-61721326 CTCAGGTGGTCCGCTTGCCTCGG + Intergenic
1112235363 13:97631072-97631094 GTCAGGCAGTGTGCTGGCCTCGG + Intergenic
1112290740 13:98142894-98142916 CCCCGGCGGCGCGCTGGGCTCGG + Intronic
1114080434 14:19198565-19198587 CTCAGGCAGGGAGATGGCCCTGG - Intergenic
1118019139 14:61693473-61693495 CTCAGGTGGTCCGCTCGCCTCGG - Intergenic
1118320642 14:64750540-64750562 CTCAGGCGGTCCGCCCGCCTCGG - Intronic
1118789397 14:69075715-69075737 CTCAGGTGATCCGCTGGCCTTGG + Intronic
1119851948 14:77872562-77872584 CTCAGATGGGGGGCTGGCCTTGG + Intronic
1121054782 14:90843680-90843702 CTCAGGCGATCCGCTCGCCTTGG + Intergenic
1121088222 14:91163022-91163044 CTCAGGCAGTCCGCTGGCCTCGG - Intronic
1122793659 14:104195074-104195096 CTCAGGTGGGCTGCTGTCCTTGG - Intergenic
1122905081 14:104797873-104797895 CTCAGGCGGCCATCTGGCCTGGG - Intergenic
1123041325 14:105491416-105491438 CTCAGGCAGGGCCCCGGCCCGGG - Exonic
1123186032 14:106517860-106517882 CTCAGGCGGGGCTCAGGCTGTGG - Intergenic
1123705494 15:22947979-22948001 CTCAGGAGGAGCTCTGCCCTGGG + Intronic
1125485402 15:40107949-40107971 CTCTGGAGGGGTGCTGGCCAAGG + Intronic
1125825540 15:42673166-42673188 CTCAGGCGATCCGCTAGCCTTGG - Intronic
1125853492 15:42926601-42926623 CTCAGGTGATCCGCTGGCCTCGG + Intergenic
1127291444 15:57574651-57574673 CTTGGGTGGGGGGCTGGCCTGGG + Intergenic
1127772779 15:62244280-62244302 CTCTGGGGAGGGGCTGGCCTAGG - Intergenic
1129015399 15:72463350-72463372 CTCAGGCGATCCGCTCGCCTCGG + Intergenic
1129462791 15:75708237-75708259 CACAGGCTGGGAGCCGGCCTGGG + Intronic
1129722083 15:77883179-77883201 CACAGGCTGGGAGCCGGCCTGGG - Intergenic
1130956680 15:88631781-88631803 AGCAGGTGGGGCGCTGGCCTCGG + Exonic
1130999918 15:88931740-88931762 CTCAGGTGATTCGCTGGCCTTGG - Intergenic
1131054377 15:89367088-89367110 CTTGGGCGAGGCCCTGGCCTGGG - Intergenic
1131115488 15:89792634-89792656 CTTAGGCAGGGTGCCGGCCTGGG - Intronic
1131120632 15:89821398-89821420 CACAAGCTGGGCACTGGCCTGGG - Intergenic
1131121051 15:89823619-89823641 CACAAGCTGGGCACTGGCCTGGG + Intergenic
1131122268 15:89830031-89830053 CTCACTCGGGGGGCTGGGCTGGG + Intergenic
1131137804 15:89951814-89951836 CTCAGGCAGTTCTCTGGCCTTGG - Intergenic
1131254399 15:90852558-90852580 CTCATGCCAGGCGCTGGCCTGGG - Intergenic
1131494494 15:92894100-92894122 CTCAGGGGATGTGCTGGCCTTGG + Intronic
1132528033 16:426987-427009 CCCAGGCGAGGAGCTGACCTCGG - Intronic
1132571488 16:646326-646348 CTCAGGCAGCGGGCAGGCCTGGG + Intronic
1132689326 16:1175459-1175481 CTCCTGCTGGGCCCTGGCCTGGG + Intronic
1135607427 16:23836384-23836406 CCCTGGCGCGGCGCTGCCCTCGG - Intronic
1135870672 16:26147047-26147069 CTCAGGTGATCCGCTGGCCTTGG + Intergenic
1136228855 16:28875611-28875633 CCCAGGCGGGGGGCTAGCCGAGG + Intergenic
1136378756 16:29881005-29881027 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1136528411 16:30848654-30848676 CTCAGGCGATCTGCTGGCCTCGG - Intronic
1137000014 16:35221574-35221596 CTCAGGTGGGGGCCGGGCCTTGG + Intergenic
1137650717 16:50117849-50117871 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
1138555200 16:57766836-57766858 CTGGGGGTGGGCGCTGGCCTCGG - Intronic
1138672933 16:58629929-58629951 CACAGGCGGGGCGCGGCCATTGG - Intergenic
1139517835 16:67462232-67462254 CTCAGGCTGGGCTGTGGCCAGGG - Intronic
1139577093 16:67848347-67848369 CTCAGGTGATCCGCTGGCCTTGG - Intronic
1140169578 16:72589695-72589717 CTCAGGTGATCCGCTGGCCTTGG + Intergenic
1140580735 16:76228053-76228075 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
1141461809 16:84182268-84182290 CACTGGGGGCGCGCTGGCCTGGG - Exonic
1142018317 16:87764414-87764436 CTCAGGTGATGCGCTCGCCTCGG - Intronic
1142113952 16:88346796-88346818 CTCAGGCAGCGAGCTGGCCCTGG + Intergenic
1142413235 16:89926511-89926533 CTCGGCCCGGGCGCTGTCCTTGG - Intronic
1142624842 17:1185409-1185431 CTCAGGTGACCCGCTGGCCTCGG - Intronic
1142864198 17:2780393-2780415 GTCAAACGGGGCGGTGGCCTGGG - Intronic
1142985739 17:3694599-3694621 CTCAGGGGGGGCTCTCTCCTTGG - Intronic
1143037525 17:4007870-4007892 CTCAGGCAGGGCTCTTGGCTGGG + Intronic
1143241550 17:5447282-5447304 CTCAGGCGATCCACTGGCCTTGG - Intronic
1143313203 17:6010609-6010631 CTCAGGTGATTCGCTGGCCTTGG + Intronic
1143879981 17:10022670-10022692 CTCAGGACAGGCGCTGCCCTAGG - Intronic
1144020925 17:11240173-11240195 CTCAGGCAGCGCGCTGCCCCGGG + Intergenic
1144038273 17:11386699-11386721 CTCAGGCGGGGCGCTGGCCTTGG + Intronic
1144661879 17:17076239-17076261 CTCTAGCGGGGCCCTGCCCTGGG - Intronic
1144947722 17:18978286-18978308 CTGGTGCTGGGCGCTGGCCTGGG + Exonic
1145006437 17:19341258-19341280 CTCACCCAGGGCACTGGCCTTGG - Intronic
1145257941 17:21337764-21337786 CTCTGGCCGGGAGGTGGCCTCGG + Intergenic
1145991212 17:29080503-29080525 CTGAGCCGGGCCTCTGGCCTAGG - Intronic
1146936942 17:36817888-36817910 ATCAGGTGGCGAGCTGGCCTGGG + Intergenic
1148708116 17:49654549-49654571 CTCAGGCAATCCGCTGGCCTCGG - Intronic
1149936474 17:60811812-60811834 CTCAAGCGATCCGCTGGCCTTGG - Intronic
1150067168 17:62120775-62120797 CTCAGGCGATCCGCTCGCCTTGG - Intergenic
1150764261 17:67990861-67990883 CTCAGGTGATCCGCTGGCCTCGG + Intergenic
1150772161 17:68051378-68051400 CTCAGGCGATCCGCCGGCCTAGG + Intergenic
1151072888 17:71236378-71236400 CTCAGGTGATCCGCTGGCCTTGG + Intergenic
1151803486 17:76391312-76391334 CTCTGGCGAGCTGCTGGCCTTGG + Exonic
1151838778 17:76602346-76602368 CTCAGGCGGTCCGCCTGCCTTGG - Intergenic
1152400578 17:80064214-80064236 CTCATGCCCGGCGCTGCCCTCGG + Intronic
1152558037 17:81064281-81064303 CACAGCCGGGGAGGTGGCCTCGG + Intronic
1152646161 17:81469416-81469438 CTCAGGTGGGGAGCTGGGCCGGG + Intergenic
1152686446 17:81696058-81696080 CTCAGGGGAGGCCCTGGCCCAGG - Intronic
1152688841 17:81708325-81708347 CACAGCCTGGGGGCTGGCCTTGG - Intergenic
1155031815 18:21991395-21991417 CTCAGTTGGGGCTCTGGGCTGGG + Intergenic
1159794748 18:72828077-72828099 CTCAGGTGATCCGCTGGCCTTGG - Intronic
1160541762 18:79627767-79627789 CTCAGGCGGGGCGCTTTCATGGG + Intergenic
1160553802 18:79713532-79713554 GTCAGGCTGGGCGCTGGCTGGGG + Intronic
1160775365 19:852871-852893 CCCAGGCACCGCGCTGGCCTCGG + Exonic
1160999971 19:1905639-1905661 CGCGCGCGCGGCGCTGGCCTGGG + Intronic
1162079543 19:8209840-8209862 CGCAGCTGGGGCCCTGGCCTCGG + Intronic
1162947397 19:14052187-14052209 GTCAAGCGGGGCGGTGGCCTGGG - Exonic
1163472370 19:17505125-17505147 CTCAGGTGATCCGCTGGCCTCGG + Exonic
1163806037 19:19398432-19398454 CTCAGGCGATCCGCTTGCCTCGG + Intronic
1167060887 19:47145378-47145400 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1167154801 19:47731541-47731563 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1167532154 19:50024920-50024942 CGCAGGTGGGGCGATTGCCTAGG + Intronic
1168035239 19:53714119-53714141 CTCAAGTGAGCCGCTGGCCTCGG + Intergenic
1168078172 19:53991757-53991779 CCGAGGGGGGGCCCTGGCCTGGG + Intergenic
1168245384 19:55110637-55110659 CTCAGGCGATCTGCTGGCCTCGG - Intronic
926263502 2:11291314-11291336 CTCAGGCGATGCGCCCGCCTCGG - Intronic
927555791 2:24030814-24030836 CTCAGGCGAAGCGCTTGCCATGG - Exonic
928314853 2:30237097-30237119 CTCAGGCTCGGCTCAGGCCTGGG + Intronic
929460240 2:42097996-42098018 CTCAGGTGGTCCGCTGGCTTTGG - Intergenic
930073882 2:47391124-47391146 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
930115387 2:47713695-47713717 CTCAGGCGATCAGCTGGCCTCGG - Intronic
930174722 2:48290092-48290114 CTCAGGTGATCCGCTGGCCTAGG - Intergenic
931147302 2:59533411-59533433 CTCAGGCAATCCGCTGGCCTCGG + Intergenic
931608094 2:64071745-64071767 CTCAGGTGGTCCACTGGCCTTGG + Intergenic
931925755 2:67070739-67070761 CTCAGGTGGGGAGTTGGGCTGGG + Intergenic
932330563 2:70896300-70896322 CTCCGGCGGTGCGCAGGCGTCGG - Intergenic
934098134 2:88626779-88626801 CCCAGGCAGGTCGCTGGCCGGGG + Intronic
936589818 2:113792930-113792952 CTCAGGCGATCCACTGGCCTCGG + Intergenic
939052683 2:137327223-137327245 CTCAGGCTTGGCAGTGGCCTAGG - Intronic
944889263 2:204100078-204100100 CTCAGGTGGGCCGCCTGCCTCGG + Intergenic
948136283 2:235638792-235638814 CCCAGGCGGAGGGCTGGCGTGGG + Intronic
1169203970 20:3729946-3729968 CTCAGGGCTGGGGCTGGCCTAGG + Intergenic
1170181342 20:13533759-13533781 AGCAGGCTGGGCACTGGCCTGGG - Intronic
1170487603 20:16835303-16835325 CTCAGGTGGTCCGCTTGCCTCGG + Intergenic
1170941016 20:20848086-20848108 CGCAGGCAGGTGGCTGGCCTTGG + Intergenic
1171123595 20:22584493-22584515 CTACCGCGGGGCGCTGGCCTGGG - Intronic
1171271699 20:23823408-23823430 CACAGGCAGGGCTCAGGCCTCGG - Intergenic
1171511230 20:25686280-25686302 CCCAGGAGCGGTGCTGGCCTTGG + Intronic
1172675982 20:36672593-36672615 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1172981853 20:38949391-38949413 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1173727774 20:45309011-45309033 CTCAGGATGGGGGATGGCCTGGG - Intronic
1174377429 20:50135423-50135445 CTCAGGCGATCCGCTTGCCTCGG - Intronic
1174557448 20:51406008-51406030 CTCAGGTGATCCGCTGGCCTTGG + Intronic
1174802294 20:53574559-53574581 CTCAGGTGATGCACTGGCCTCGG - Intronic
1175179227 20:57133466-57133488 CTCAGGTGGGGAGCAGGGCTTGG + Intergenic
1175580147 20:60092304-60092326 CTCAGGAGGGGAACTGGGCTGGG + Intergenic
1175756499 20:61533529-61533551 CCCTGGCGGGGCCCTGGCCGGGG + Intronic
1175918349 20:62438098-62438120 CTGAGGCGGGCAGCTGGCCAGGG - Intergenic
1175963340 20:62648056-62648078 CTCCGGCTGGGGGCAGGCCTGGG - Intronic
1176034745 20:63030731-63030753 CTCAGGCGGTGCCCTGGCCTCGG + Intergenic
1176188205 20:63793107-63793129 GTCAGGCGGGGGCCTGGTCTTGG - Intronic
1176347422 21:5762326-5762348 CTCAAGCGAGCCACTGGCCTTGG - Intergenic
1176354236 21:5882910-5882932 CTCAAGCGAGCCACTGGCCTTGG - Intergenic
1176497405 21:7562129-7562151 CTCAAGCGAGCCACTGGCCTTGG + Intergenic
1176541743 21:8160396-8160418 CTCAAGCGAGCCACTGGCCTTGG - Intergenic
1176560694 21:8343441-8343463 CTCAAGCGAGCCACTGGCCTTGG - Intergenic
1178421982 21:32450596-32450618 TTCAGAAGGGGCACTGGCCTAGG + Intronic
1179660653 21:42872699-42872721 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1179675948 21:42982145-42982167 TTCGGGCTGGGGGCTGGCCTTGG + Intronic
1179874527 21:44261438-44261460 CTCAGGGCTGGCACTGGCCTTGG - Intronic
1180843645 22:18970459-18970481 CTCGGGCGGGGCTCGGGCCGCGG - Intergenic
1180923895 22:19539086-19539108 CTCAGGTGATCCGCTGGCCTTGG + Intergenic
1182269642 22:29145376-29145398 CTCAGGAGGGGCTTTGGCCAGGG - Intronic
1182384748 22:29928403-29928425 CTCAGGTGATCCGCTGGCCTTGG + Intronic
1182856042 22:33518540-33518562 CTCAGGTGTTGCGCTGGCCTCGG + Intronic
1183350073 22:37330072-37330094 CCCAGGCAGGGCACTGGCTTGGG - Intergenic
1183623379 22:38987396-38987418 CTCAGCAGGGGGTCTGGCCTGGG - Intronic
1183702480 22:39457930-39457952 CTCCGGCGCGGCGCGGGGCTGGG + Intronic
1184130450 22:42514008-42514030 CTGAGGGCGGGCGCTGGACTTGG - Intronic
1184140627 22:42575833-42575855 CTGAGGGCGGGCGCTGGACTTGG - Intergenic
1184628214 22:45754617-45754639 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1184639516 22:45861953-45861975 CACAGGTGGAGGGCTGGCCTTGG - Intergenic
1184950402 22:47837873-47837895 CACAGGGGAGGCGCAGGCCTAGG - Intergenic
1185375655 22:50481682-50481704 GTCCGTCGGGGCGCAGGCCTCGG - Exonic
1203246683 22_KI270733v1_random:76815-76837 CTCAAGCGAGCCACTGGCCTTGG - Intergenic
950381490 3:12619328-12619350 CTCAAGTGATGCGCTGGCCTCGG - Intronic
950406959 3:12810588-12810610 CTCAGCAGGGGCTCAGGCCTGGG - Intronic
952968535 3:38636477-38636499 CTCGCTCGGGGCCCTGGCCTGGG + Intronic
953908958 3:46882381-46882403 CGCGGACGGGGCGCTGGCTTGGG + Intronic
953909070 3:46882814-46882836 CGCAAGCGGGGCTCTGGCCAAGG + Intronic
954633160 3:52057618-52057640 CGCAGGCGGCGCGCTTGCGTAGG + Intergenic
955322886 3:57986875-57986897 CTGAGGCGGGGGGATTGCCTGGG - Intergenic
957995379 3:87682510-87682532 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
959255004 3:103998590-103998612 CTCAGGTGATCCGCTGGCCTCGG - Intergenic
960110208 3:113838336-113838358 CTCAGGCAATCCGCTGGCCTTGG - Intronic
961252867 3:125521420-125521442 CTCAGGCGATCCGCCGGCCTTGG - Intergenic
961325510 3:126107013-126107035 CTCAGGCAGGGCGCAAGCCGTGG - Intronic
961346600 3:126267425-126267447 CTGGGGCGGTGCGCTGGCCGTGG + Intergenic
961881622 3:130065441-130065463 TTCAGAAGGGGCACTGGCCTAGG - Intergenic
964309170 3:155374101-155374123 GTCAGGAGGGGATCTGGCCTTGG - Intergenic
964357615 3:155864953-155864975 CTCAGGTGAGCCGCAGGCCTCGG - Intergenic
964451511 3:156817062-156817084 CGCAGGCGGCGCGGCGGCCTGGG + Intergenic
967317176 3:188160425-188160447 CTCAGGTGATCCGCTGGCCTTGG + Intronic
968947015 4:3670514-3670536 CTGAGGAGGGCCGCTGGACTCGG - Intergenic
968993938 4:3933546-3933568 TTCAGAAGGGGCACTGGCCTAGG - Intergenic
969213894 4:5708332-5708354 CTCAGGCCGGGCCCAGACCTAGG + Exonic
969259672 4:6025413-6025435 ATCAGGCAGGGCCCTGGCCTGGG + Intergenic
969492853 4:7509829-7509851 CTCAGGAGGGGCCCTGACATAGG + Intronic
969822291 4:9730041-9730063 TTCAGAAGGGGCACTGGCCTAGG + Intergenic
976268945 4:83211278-83211300 CTCAGGTGACCCGCTGGCCTCGG + Intergenic
976610117 4:87021967-87021989 CTCAGGTGATCCGCTGGCCTCGG - Intronic
978620744 4:110632766-110632788 CTGTGGCGGGGCGGTGGACTAGG - Intronic
980059907 4:128117751-128117773 CTCAGGTGAACCGCTGGCCTCGG + Intronic
982028973 4:151279844-151279866 CTGCTGCAGGGCGCTGGCCTTGG + Exonic
982358322 4:154492105-154492127 CGCAGGCGGGGCGTCTGCCTGGG + Intergenic
985718686 5:1477092-1477114 AGCCAGCGGGGCGCTGGCCTGGG - Intronic
986410568 5:7475015-7475037 GGCAGGAGGGTCGCTGGCCTGGG + Intronic
987090265 5:14503833-14503855 CTCAGGTGGGGGCCTGGGCTGGG - Intronic
987182723 5:15384806-15384828 CTCAGGCAGCTCCCTGGCCTTGG + Intergenic
987502851 5:18735528-18735550 CTCAGGCAATCCGCTGGCCTCGG - Intergenic
991734906 5:69622968-69622990 CTCAGGAGATCCGCTGGCCTTGG + Intergenic
991780072 5:70123750-70123772 CTCAGGAGATCCGCTGGCCTTGG - Intergenic
991811340 5:70478103-70478125 CTCAGGAGATCCGCTGGCCTTGG + Intergenic
991859359 5:70999180-70999202 CTCAGGAGATCCGCTGGCCTTGG - Intronic
991872519 5:71124073-71124095 CTCAGGAGATCCGCTGGCCTTGG - Intergenic
992671894 5:79069655-79069677 CTCAGGCTGCCCGCTGGCCTCGG - Intronic
994311622 5:98278801-98278823 CTCAGGCAATCCGCTGGCCTCGG + Intergenic
994546790 5:101177045-101177067 CTCAGGGGTGGCGCTGCCCAAGG + Intergenic
995049402 5:107685030-107685052 CTCAGGTGATGCGCTTGCCTTGG + Intergenic
995241023 5:109885329-109885351 CGCAGCCGAGGCGCCGGCCTGGG - Intergenic
997951079 5:138243020-138243042 CTCAGGTGGTCCACTGGCCTCGG - Intergenic
1001302420 5:170544177-170544199 CTCAGGTGATTCGCTGGCCTCGG - Intronic
1001491065 5:172155759-172155781 CTCAGGTGATCCGCTGGCCTTGG - Intronic
1001526269 5:172430822-172430844 CTCAAGTGGGGCGTTGGCCAGGG - Intronic
1001680501 5:173553599-173553621 CTCAGGTGATCCGCTGGCCTTGG + Intergenic
1002207787 5:177575818-177575840 CACAGGTGGGGCACTGGCTTTGG - Intergenic
1003472426 6:6449695-6449717 CTCAGGTGGTCCGCTTGCCTCGG + Intergenic
1004536901 6:16511874-16511896 CTAAGGCAGGGCGGTGGCCTGGG - Intronic
1004912487 6:20300356-20300378 CTCAGGTGATCCGCTGGCCTTGG - Intergenic
1005516041 6:26555263-26555285 CTCAGGCGGCTCGTTGGTCTAGG + Intergenic
1005831425 6:29673858-29673880 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1006108870 6:31732774-31732796 CTCAGGTGGTGCGCTAGCCTCGG + Intronic
1007423671 6:41734308-41734330 CTCACCCGGGGCGCGGGGCTGGG + Intronic
1007651654 6:43426228-43426250 CTCAGGTGATGCGCTTGCCTTGG - Intergenic
1010083072 6:71886636-71886658 CTCCGGCGGGGCGCGGGGCGGGG - Intergenic
1015947581 6:138518782-138518804 CTCAGGCGATCTGCTGGCCTTGG - Intronic
1016590195 6:145735442-145735464 CTCCGGCCGGGCGCCGGCCACGG + Exonic
1017586860 6:155936127-155936149 CTCAGGTGATCCGCTGGCCTCGG + Intergenic
1019109997 6:169702134-169702156 CTCCGGCGAGGCTCCGGCCTCGG + Intergenic
1019179562 6:170177819-170177841 CTCAGCTGGAGCTCTGGCCTGGG + Intergenic
1019532973 7:1512844-1512866 CTGAGGCTGGGGGCTGCCCTGGG + Intergenic
1019810016 7:3158336-3158358 CTCAGGCCTGACCCTGGCCTTGG - Intronic
1020165027 7:5800941-5800963 CTCAAGCGGTCCGCTCGCCTCGG + Intergenic
1021969414 7:25951540-25951562 CTCGGGCCGGGCGCTGTCCCCGG + Intergenic
1023998859 7:45178045-45178067 CCCAGGGGGTGCCCTGGCCTGGG + Intronic
1026232683 7:68499065-68499087 CTCAGGCGATCCGCTCGCCTTGG - Intergenic
1026332392 7:69364047-69364069 CTCAGGTGGTCCGCTGGCCTCGG - Intergenic
1026974712 7:74490341-74490363 CTCAGGCCAGGCTCTGGGCTGGG - Intronic
1026996517 7:74620281-74620303 CTCAGGTGATCCGCTGGCCTTGG - Intergenic
1029112627 7:98221558-98221580 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1029543531 7:101198509-101198531 CTCAGGCTGGCCCCTGTCCTGGG + Intronic
1029837197 7:103325208-103325230 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1032395314 7:131585222-131585244 CTCAGGCGAGCCTCTTGCCTTGG - Intergenic
1032787414 7:135211656-135211678 CTCGGGCGGGGAGCCGGCCGAGG - Intergenic
1035194231 7:157202421-157202443 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1035637358 8:1156623-1156645 CTGAGCCGGGGCGCTGGGCTGGG - Intergenic
1035637366 8:1156649-1156671 CTAAGCTGGGGCGCTGGGCTGGG - Intergenic
1035928885 8:3759658-3759680 CTCAGGTGGTCCGCTGACCTTGG - Intronic
1036177828 8:6556023-6556045 CTCAGGCCTGATGCTGGCCTAGG + Intronic
1039779457 8:40770067-40770089 CTCAGGCAGTGCCCTTGCCTAGG + Intronic
1041552414 8:59118045-59118067 CGGAGGTGGGGCGCTGGCCTGGG - Intronic
1042342190 8:67692101-67692123 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1042888875 8:73585245-73585267 CTCAGGTGAGCCGCTCGCCTCGG - Intronic
1042956657 8:74258156-74258178 CTCATGCAGGGTGCTGGGCTAGG + Intronic
1042962874 8:74321516-74321538 CTCGCGCGCGGCGCTGGCCCAGG - Intronic
1044856917 8:96485808-96485830 CTCATGCGTGGGGCTGGGCTCGG + Intergenic
1045854701 8:106750561-106750583 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1046669569 8:117042907-117042929 CTCAGGTGATCCGCTGGCCTTGG + Intronic
1049194842 8:141309083-141309105 CTCAGGCTTGGCCCTGGCCAGGG + Intergenic
1049324924 8:142016895-142016917 CTCAGGAAGGGCACTGGCCGTGG + Intergenic
1049583539 8:143423077-143423099 CTGAGGCGGGAGGCTGGCCCAGG - Intronic
1049613209 8:143565375-143565397 CTGAGGCGGGGAGCTGGCTGTGG - Intergenic
1049779981 8:144424482-144424504 TTCTGGCGGGGTCCTGGCCTCGG - Intronic
1055269703 9:74544159-74544181 CTCAGGCTTGCCGCTTGCCTTGG + Intronic
1055280553 9:74669243-74669265 CTCAGGTGATCCGCTGGCCTCGG - Intronic
1055746346 9:79449693-79449715 CTCAGGTGATCCGCTGGCCTCGG + Intergenic
1056944782 9:90985001-90985023 CTCAGGTGACCCGCTGGCCTCGG - Intergenic
1056963583 9:91147507-91147529 CTCAGGAGGGGCCTTTGCCTGGG - Intergenic
1057432242 9:95004969-95004991 CTCAGGCGCGGCGCGGGCGGCGG - Intronic
1057524520 9:95786716-95786738 CTCAGGCTGGGAGGTGCCCTGGG + Intergenic
1058485126 9:105435962-105435984 CTCAGGTGGTCCGCAGGCCTTGG - Intronic
1059771413 9:117430041-117430063 CTCAAGCCAGGGGCTGGCCTTGG - Intergenic
1060182785 9:121545735-121545757 CTGAGGCGCAGCGCTGGGCTGGG + Intergenic
1061148899 9:128817873-128817895 CTCAGGCGATCCGCCGGCCTCGG - Intergenic
1061264517 9:129497383-129497405 GTGGGGCGGGGCGCTGGGCTTGG + Intergenic
1061377492 9:130235052-130235074 CTCAGGGGGGACGCTGGGGTTGG - Exonic
1061572800 9:131488040-131488062 CTCAGCCAGGCTGCTGGCCTGGG + Exonic
1061872997 9:133530535-133530557 CTCAGGCGGGGTCCAAGCCTTGG + Intergenic
1062142510 9:134967352-134967374 CCCACGCGGGGCGCTGCCGTGGG - Intergenic
1062234054 9:135499786-135499808 CTCCGGCGGGGCCGTGGCCTTGG + Exonic
1062525079 9:136974913-136974935 CGCAGGCAGGGGGATGGCCTTGG + Intergenic
1203463016 Un_GL000220v1:59877-59899 CTCAAGCGAGCCACTGGCCTTGG - Intergenic
1185433791 X:25474-25496 CTCAGGTGAGCTGCTGGCCTTGG - Intergenic
1185442997 X:237541-237563 CTCAGGTGAGCTGCTGGCCTTGG - Intergenic
1185460935 X:332547-332569 TTCTGGCGGGACGCTGGCCACGG + Intergenic
1185778740 X:2828608-2828630 CTCTTGCTGCGCGCTGGCCTTGG + Intergenic
1186367350 X:8909625-8909647 CTGAGGCGGGACGATTGCCTGGG - Intergenic
1186471766 X:9827464-9827486 CTCAGGCAGGCCCCTGGCCGGGG - Intronic
1190440489 X:50470634-50470656 CTGAGGCGGGGCAGTGCCCTGGG + Exonic
1190861435 X:54348402-54348424 CTCAGGTGATCCGCTGGCCTCGG + Intronic
1192118510 X:68433549-68433571 CTGGGGCGGGGCGCAGGCGTTGG - Exonic
1192218274 X:69178994-69179016 TTCAGACTGGGAGCTGGCCTAGG - Intergenic
1195087112 X:101423141-101423163 CTCAGGCGATCCACTGGCCTCGG + Intronic
1197759682 X:130019197-130019219 CTCAGGTGATCCGCTGGCCTTGG + Intronic
1199246680 X:145613061-145613083 CTCAGGTGATCCGCTGGCCTTGG - Intergenic
1201291274 Y:12421897-12421919 CTCGGGCTGCGCGCTGGCCTTGG - Intergenic
1201747184 Y:17389846-17389868 CTCAGGCGATCCACTGGCCTTGG + Intergenic
1202173083 Y:22072051-22072073 CTGAGGAGGGGCACTGCCCTGGG - Exonic
1202218277 Y:22514320-22514342 CTGAGGAGGGGCACTGCCCTGGG + Exonic
1202324909 Y:23681735-23681757 CTGAGGAGGGGCACTGCCCTGGG - Intergenic
1202545862 Y:25988319-25988341 CTGAGGAGGGGCACTGCCCTGGG + Intergenic