ID: 1144040025

View in Genome Browser
Species Human (GRCh38)
Location 17:11402464-11402486
Sequence CCTCTCATTAAGTGGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 186}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144040025_1144040028 5 Left 1144040025 17:11402464-11402486 CCTCTTTTCCACTTAATGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 186
Right 1144040028 17:11402492-11402514 TCAGCCTATCAGCCTTTGTAAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1144040025_1144040032 20 Left 1144040025 17:11402464-11402486 CCTCTTTTCCACTTAATGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 186
Right 1144040032 17:11402507-11402529 TTGTAAGGGAATACACCCTTAGG 0: 1
1: 0
2: 0
3: 7
4: 71
1144040025_1144040029 6 Left 1144040025 17:11402464-11402486 CCTCTTTTCCACTTAATGAGAGG 0: 1
1: 0
2: 0
3: 24
4: 186
Right 1144040029 17:11402493-11402515 CAGCCTATCAGCCTTTGTAAGGG 0: 1
1: 0
2: 2
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144040025 Original CRISPR CCTCTCATTAAGTGGAAAAG AGG (reversed) Intronic
900760337 1:4466329-4466351 CCTTTGCTTAAGTGGAAATGTGG - Intergenic
902875742 1:19339768-19339790 CCTCTCAGAAAGGGGCAAAGGGG + Intronic
903260098 1:22127003-22127025 CCACTGACTAAGAGGAAAAGGGG - Intronic
908834015 1:68210457-68210479 CTTATCATTCAGTGGAAAACTGG - Intronic
909963212 1:81874446-81874468 AATTTCATTAAGAGGAAAAGAGG - Intronic
911904711 1:103552192-103552214 CCCCTCATTAAAAGGAAAACTGG - Intronic
915856768 1:159396988-159397010 CTTCTCCTTAAGTGGAAGAAAGG - Intergenic
917189944 1:172404785-172404807 CTTCATTTTAAGTGGAAAAGTGG - Intronic
920744846 1:208616888-208616910 CCTCTCCTCAAGTGGAAGAAGGG - Intergenic
920818756 1:209360482-209360504 TCCCTCATTAAGTAGGAAAGTGG + Intergenic
921319035 1:213919373-213919395 CCTCTCACTTAGTGGAAGATGGG + Intergenic
923850554 1:237789832-237789854 GCTCTCACTTAGGGGAAAAGGGG - Intronic
1067781251 10:49209072-49209094 CCCCTCATCAAGTGAAAAAGGGG + Intergenic
1068372708 10:56138612-56138634 AATCTCATTCAGTGGAAAGGTGG - Intergenic
1069684880 10:70311531-70311553 CCTCTCATTATCTGGAATAGTGG - Intronic
1070674030 10:78399597-78399619 CCACTCATCATGTGGAAAAGTGG + Intergenic
1071962926 10:90824115-90824137 CCTCTCCTTAAGTGGAAGGAAGG - Intronic
1074351540 10:112742225-112742247 CCTCTAAATAAGTTGACAAGTGG + Intronic
1075790079 10:125077806-125077828 CCTCTCATTTAGTCCAAACGGGG + Intronic
1077753221 11:4997183-4997205 CTTCTCATTACATGGAGAAGAGG + Intergenic
1088091495 11:106045652-106045674 CCTCTCACTCAGTAGAAAAAAGG - Intergenic
1088725189 11:112628320-112628342 CCTCTCCTAAAGAGGCAAAGGGG - Intergenic
1093628294 12:21378233-21378255 CCAGTCATCAGGTGGAAAAGCGG + Exonic
1093738156 12:22648376-22648398 CCACTGGTTAAGGGGAAAAGAGG - Intronic
1094258508 12:28464431-28464453 CCTCTCCTTAAGTGGAAGGAAGG - Intronic
1095573675 12:43710378-43710400 CCTCTCCTTAAGGAGAAGAGAGG - Intergenic
1096613150 12:52816152-52816174 CCTCTAAGTAAGTGGAGAGGGGG + Intergenic
1097147060 12:56949029-56949051 CCTCTCCTCAAGTGGAAGAAAGG + Intergenic
1098162760 12:67661988-67662010 CCACCCATTAAGTTTAAAAGTGG - Exonic
1099975423 12:89541326-89541348 CCTCTCAGTAAGTGAAGAAGAGG + Intergenic
1100959069 12:99942998-99943020 ACTTTGATTAAATGGAAAAGAGG + Intronic
1104574168 12:129951443-129951465 CTTCCCATTAAGTGAACAAGTGG + Intergenic
1108243377 13:48490743-48490765 CGTCTCATAAAGAGAAAAAGCGG - Intronic
1108640926 13:52381599-52381621 CCACTGATTATGTGGAAAAAAGG - Intronic
1108801120 13:54095863-54095885 CTTGTTATTAAATGGAAAAGTGG + Intergenic
1110487617 13:76065602-76065624 ACTCTCATTAAGTGGAGGAAAGG + Intergenic
1115764194 14:36605968-36605990 CCTCTGATTAAGTTGTACAGTGG + Intergenic
1116176145 14:41473068-41473090 CCTCTCCTTAAGTGGAAGGAAGG + Intergenic
1121244930 14:92455205-92455227 CCTCACATTAAGTGGGCTAGCGG - Intronic
1122373493 14:101242719-101242741 CCTTACATTAGCTGGAAAAGCGG - Intergenic
1124321885 15:28719240-28719262 CCTCTGAATAAATTGAAAAGAGG - Intronic
1128026291 15:64439975-64439997 CCACTGATTCAGTGGAAAATGGG - Intronic
1130803181 15:87288521-87288543 ACTATCATAAAGTGGACAAGTGG + Intergenic
1131607951 15:93929076-93929098 CCTCATATAAAGTGGAAAATTGG + Intergenic
1131733288 15:95304724-95304746 CATCTCTTTAAGAGGAAAGGGGG + Intergenic
1140140676 16:72253976-72253998 CCTCTGTTTAATTGGATAAGGGG + Intergenic
1140327074 16:74014891-74014913 CCTATGATTAAGGGGAAAAGTGG - Intergenic
1141037407 16:80640209-80640231 CCTCTCCTCAAGTGGAAAGGAGG - Intronic
1144040025 17:11402464-11402486 CCTCTCATTAAGTGGAAAAGAGG - Intronic
1146999740 17:37353034-37353056 TCTCATATTAAGTGGAAAACTGG + Intronic
1151144652 17:72029889-72029911 CCCCTGATTAAGTGCAAAGGTGG + Intergenic
1151947161 17:77325967-77325989 CCTCTCCCTAAGTGGAAGTGGGG + Intronic
1154230513 18:12552383-12552405 CCTCTCTTCAAGTGGAAAAAAGG - Intronic
1156089320 18:33446080-33446102 CCTACCATTAAGGGGAAAAAAGG - Intergenic
1157196393 18:45623567-45623589 CCTCTCATTAGGAGGAGGAGAGG + Intronic
1157239261 18:45994390-45994412 CTCCTCATAGAGTGGAAAAGGGG - Intronic
1158082093 18:53604794-53604816 CCTCCCTTTAAGTGGTAAATGGG - Intergenic
1158409671 18:57194338-57194360 CCTTTCATTAAAAAGAAAAGGGG - Intergenic
1159101761 18:63966112-63966134 CCTCTCCCTAAGTGGAACACTGG + Intronic
1160514009 18:79468728-79468750 CCTCTCAAGATGTGGAAAATGGG + Intronic
1164828498 19:31301909-31301931 CGTCTGATGAAGTGGAAAACCGG + Intronic
1165983994 19:39751615-39751637 CCTCTCTTTAAGTGAAAGAAAGG - Intergenic
1166570499 19:43793218-43793240 GCTCTCACTAAGTAGAACAGGGG - Intergenic
927899622 2:26809919-26809941 CCTGTCTTCAGGTGGAAAAGTGG - Intergenic
929809882 2:45180712-45180734 CCACTTATTAAGTGGCAGAGGGG + Intergenic
932949672 2:76278320-76278342 CTTCTCATTAAATGAAAATGAGG + Intergenic
935245361 2:101214475-101214497 CAACTCATTTAGTAGAAAAGGGG + Intronic
935437913 2:103056494-103056516 CCTCTCCTTAAGTAGAAAGAAGG + Intergenic
936279388 2:111123977-111123999 CTTCTCATAAAGATGAAAAGCGG - Exonic
937086461 2:119175026-119175048 GCTCTCATTAATTGGGAAACTGG + Intergenic
940429817 2:153576162-153576184 CCTCTCCTCAAGTGGAAAGACGG + Intergenic
941286868 2:163625257-163625279 CTTATCATTAAGAGGAAAAATGG + Intronic
943780441 2:191817528-191817550 CCACTCATTAAATGAAAAAGTGG - Intergenic
943923252 2:193738080-193738102 GCTCTCATCAAGTGGAAATAAGG - Intergenic
945754512 2:213829909-213829931 CCTCTCATGAAGTGGAAGGAAGG + Intronic
1170159115 20:13294802-13294824 TCTCTCATAAAGTTGCAAAGAGG - Intronic
1172406578 20:34694212-34694234 CATCTCATTCAGTGGAGAGGAGG + Intergenic
1174120212 20:48259458-48259480 CTAATCATTAAGTGGCAAAGGGG - Intergenic
1178333102 21:31718370-31718392 CCTCTAAGCAAGTGGAAAAGTGG - Intronic
1178581044 21:33839051-33839073 CCTGCCATTCAGTGGAAAAGTGG + Intronic
1180243829 21:46532415-46532437 CCTCTCATTAACAAGAAGAGAGG - Intronic
1182172684 22:28248823-28248845 GTTCTTATTATGTGGAAAAGGGG - Intronic
1185131164 22:49039760-49039782 CCTCTCACTAAGGGGAAGACTGG - Intergenic
1185299386 22:50071743-50071765 CCTCACAATAAGTGGGAAAAGGG - Intronic
949448592 3:4162215-4162237 CCTCTCCTCAAGTGGAAGAAAGG + Intronic
951161930 3:19433868-19433890 CATCTCATAAAATGGAAAAGGGG + Intronic
951376082 3:21919568-21919590 GCTCTCTTGAAGTGGAAATGTGG - Intronic
957618313 3:82562282-82562304 TCTCTCATTTAGTTGAAAAAGGG - Intergenic
958765384 3:98361107-98361129 CCTCTCCTCAAGTGGAAGAAAGG + Intergenic
959344861 3:105180898-105180920 ACTCTGATTTAGTGGAAAATGGG + Intergenic
959981109 3:112518783-112518805 CCTCTCATTATTTAGAAAGGGGG + Intergenic
960207365 3:114918769-114918791 CCTCTCCTCAAGTGGAATAAAGG + Intronic
960304085 3:116040015-116040037 ACTCCCAGTAAGTAGAAAAGGGG - Intronic
960631202 3:119732885-119732907 CCTCTTATGAAGTTCAAAAGAGG + Intronic
960824854 3:121771827-121771849 TCTCTCATTAAATGGATCAGTGG + Intronic
962068119 3:132004982-132005004 CCACTAATAAGGTGGAAAAGAGG - Intronic
962151881 3:132902318-132902340 CCTCTCCTCAAGTGGAAAGAAGG - Intergenic
962410785 3:135140235-135140257 CATCTCATAAAGAGGCAAAGAGG + Intronic
962665908 3:137653452-137653474 CCCTTCATTAAGGGGAAAATTGG - Intergenic
964790621 3:160450542-160450564 ACTTTCATAAAGTGGAAAAACGG - Intronic
964871633 3:161319398-161319420 CCTCTCCTCAAGTGGAAGAAAGG - Intergenic
966831509 3:184013786-184013808 GCACTCAATAAGTGGAAGAGAGG - Intronic
969790601 4:9491659-9491681 CCTCATATTAAGAGGAAGAGAGG - Intergenic
971359965 4:25928593-25928615 CCACTTATAAAATGGAAAAGAGG - Intronic
971539419 4:27797011-27797033 CCTTTGATTAAGTAGAAAATTGG + Intergenic
972236450 4:37139202-37139224 CTGCTCATTAAGTGGAAGGGAGG - Intergenic
972417633 4:38858206-38858228 CCTCACAGTAAGTGGCCAAGTGG - Intergenic
972888185 4:43519454-43519476 CCTGTGAATAAGTGGAAAAAAGG - Intergenic
974628256 4:64451702-64451724 CCTAGAATTAAGTGGAAAATAGG - Intergenic
975832075 4:78379889-78379911 GCTCTCAAGAAATGGAAAAGAGG + Exonic
976343817 4:83976570-83976592 CTTCTCAATAAATGGAAAAAGGG - Intergenic
976857544 4:89622751-89622773 ACTATAATGAAGTGGAAAAGAGG + Intergenic
978212717 4:106157249-106157271 CCTCTCCTTAAGTGGAAAGAAGG + Intronic
978306278 4:107331884-107331906 CACCTCATGAAGTAGAAAAGAGG - Intergenic
981378000 4:144038455-144038477 CCTCTCATTCACTGGGCAAGAGG + Intergenic
981542477 4:145860255-145860277 CCTCCCCTCAAGAGGAAAAGAGG - Intronic
982372986 4:154654792-154654814 CCTCTGCTTTAGTGGAAAACAGG + Intronic
983385996 4:167062101-167062123 CCTTTTATTAATTGGAAAAGAGG + Intronic
986092649 5:4525305-4525327 CTCCTCATTTAGTGGAAAACAGG - Intergenic
989000569 5:36756154-36756176 CTTCTCATTATGAGGAAAAAAGG + Intergenic
990139489 5:52686915-52686937 CCTCTAATCCAGTGGAAAACAGG + Intergenic
991111472 5:62904640-62904662 ACTTTCAATAAGTAGAAAAGGGG + Intergenic
991599130 5:68335075-68335097 CCTCTCAGGAAATGGAAAAGAGG + Intergenic
992587081 5:78251921-78251943 CCTCTCCTCAAGTGGAAGGGAGG - Intronic
993289016 5:86040615-86040637 CAACTCATTAGGAGGAAAAGAGG + Intergenic
994294592 5:98075875-98075897 CCTATCAGTAAGTGGAAAACTGG - Intergenic
996684494 5:126265829-126265851 GCTCTCATTGAGTGGGAGAGAGG - Intergenic
999086756 5:148898864-148898886 GCTCCCATTCAGTGGAAAACTGG - Intergenic
999286290 5:150396271-150396293 TCTCTCCATAGGTGGAAAAGAGG + Exonic
999670548 5:153955670-153955692 CCTCTCATCAAGTCAACAAGAGG - Intergenic
1000762845 5:165247827-165247849 CCTCTCTTTAAGTGTCAAAAGGG - Intergenic
1001892143 5:175348566-175348588 CATCTCATAAAGTGGAAGTGAGG + Intergenic
1003332077 6:5137474-5137496 CTTCTCACTAAGTGGAGGAGTGG - Intronic
1003653014 6:7978584-7978606 CCTTTCAACAAGTGAAAAAGAGG - Intronic
1004241070 6:13923295-13923317 TTTCTTATTAAATGGAAAAGGGG - Intergenic
1005427536 6:25718389-25718411 GCTCTCATTAATTTGAAATGCGG - Intergenic
1005656955 6:27948995-27949017 GCTCACATTAAGAGGAAATGAGG - Intergenic
1006804670 6:36780262-36780284 CCCCTCATTAAGAGGAAGGGGGG - Intronic
1007022259 6:38532523-38532545 CCTCTCTTCAAGTGGAAGAAAGG - Intronic
1007100035 6:39239793-39239815 TCTCCCATTCAGTGGACAAGTGG - Intergenic
1008713452 6:54258072-54258094 CCTCAGATAAAGTGGAAAATAGG + Intronic
1009308947 6:62125581-62125603 CCTCTCTTCAAGTGGAAAGAAGG - Intronic
1012297717 6:97545854-97545876 CCTCTCCTCAAGTGGAAGATGGG + Intergenic
1013958898 6:115873875-115873897 CCTATCATCAAGTAGAAAAGGGG + Intergenic
1015034683 6:128639121-128639143 CTTTTCATTAAGTGGAAGTGTGG - Intergenic
1015117545 6:129666221-129666243 CCTCTTTTTCTGTGGAAAAGAGG + Intronic
1017318688 6:153062731-153062753 CCTCTCCTCAAGTGGAAAGAAGG - Intronic
1020485445 7:8714848-8714870 CCTCTCCTAAAGTAGGAAAGAGG + Intronic
1020498616 7:8888728-8888750 CCTTTCATTAAGTAGAAAAATGG + Intergenic
1020729205 7:11859589-11859611 CCTTTCATTACATGGAAGAGAGG + Intergenic
1021392840 7:20115526-20115548 CCTCTCAGTAGGTGGTAGAGTGG - Intergenic
1023962428 7:44937987-44938009 CCTCTGAATAAGTATAAAAGTGG + Intergenic
1026226894 7:68450205-68450227 CCTTTAATTAAGAGTAAAAGGGG - Intergenic
1027295052 7:76761669-76761691 GCTATCAACAAGTGGAAAAGTGG - Intergenic
1036912056 8:12765842-12765864 CCTGTCATCCAGTGGAAAAGAGG + Intergenic
1037034075 8:14144228-14144250 CCTCTCTTTAAGTGGAAGGATGG - Intronic
1037088949 8:14889150-14889172 CCTCTGATTCAGTGAAAAAATGG + Intronic
1037914219 8:22762671-22762693 CTTCTCCGTAAGTGGCAAAGTGG + Intronic
1039226243 8:35391681-35391703 CCTCTCAAAAAGAGGAAAATAGG + Intronic
1039431104 8:37525768-37525790 CCCCTTCTTTAGTGGAAAAGGGG + Intergenic
1043507369 8:80915764-80915786 CCTCTCAGTCAGTGGACAGGAGG - Intergenic
1043943760 8:86226867-86226889 GCTGTCACTGAGTGGAAAAGTGG - Intronic
1044768908 8:95608448-95608470 CTTCTCTTTACTTGGAAAAGAGG - Intergenic
1045041373 8:98227658-98227680 CCTCTCCTCAAGTGGAAGAAAGG + Intronic
1046794319 8:118354244-118354266 CCTCTCATTATTTGGAATAGTGG - Intronic
1048827296 8:138440778-138440800 CCTCTAATTGATTGAAAAAGTGG + Intronic
1049667910 8:143855966-143855988 CCTCACATGAAGTGGCAGAGCGG + Intergenic
1050949268 9:11567211-11567233 CCTCTCTTCAAGTGGAAGAAAGG + Intergenic
1051991135 9:23153859-23153881 CCTCTCTTTAAGTGGAAGGAAGG + Intergenic
1052166114 9:25330480-25330502 ACTATCATTAAGTGGGTAAGTGG + Intergenic
1052667049 9:31508292-31508314 CCTCTCCTTAGGTGGAAAGAAGG + Intergenic
1054863971 9:69981007-69981029 TCTCTCATTAAAGGGAAAAGGGG + Intergenic
1055101647 9:72471825-72471847 CATTAGATTAAGTGGAAAAGAGG - Intergenic
1055339308 9:75264168-75264190 CCTCTCCTTAAGTGGAAGGAAGG + Intergenic
1055864601 9:80797820-80797842 CCTCTGATTAAATTGAAAAAAGG - Intergenic
1056029740 9:82540455-82540477 TCTCTCATTATTTGGAAAACAGG + Intergenic
1058948144 9:109878002-109878024 CCTCTCATAATGTGCAAAACAGG + Intronic
1060409649 9:123391598-123391620 CCTTTCATTAAAAGTAAAAGAGG - Intronic
1187612813 X:20961023-20961045 CCTCTCATCAAGTGGAAGGAAGG - Intergenic
1187639490 X:21273060-21273082 CCTCTCCTCAAGTGGAAGAAAGG - Intergenic
1187718197 X:22124650-22124672 CCTCTCTTAAAGTTGGAAAGTGG + Intronic
1188068931 X:25695549-25695571 CCTCTCCTTAAGTGGAAGGAGGG + Intergenic
1188640055 X:32489820-32489842 CCTCTGATTCACAGGAAAAGCGG + Intronic
1188994431 X:36865732-36865754 TCTCTCATTAAGTGAAGAATTGG - Intergenic
1191694567 X:63976996-63977018 CCTCTCCTTAAGTGGAAGCCAGG - Intergenic
1191913227 X:66173780-66173802 CCTCTCATCACCTGTAAAAGAGG + Exonic
1192147587 X:68692275-68692297 CCTGCCATCAAGAGGAAAAGAGG + Intronic
1192339202 X:70248780-70248802 CTTCTCACAGAGTGGAAAAGGGG - Intergenic
1194033631 X:88845016-88845038 CACCTCATAAAGTAGAAAAGAGG + Intergenic
1194285755 X:92008054-92008076 CCTCTCTTCAAGTGGAAGAAAGG + Intronic
1194378548 X:93165828-93165850 CCTCTCCTTAAGTGGAAGGAAGG - Intergenic
1194493246 X:94577612-94577634 CCTCTCCACAAGTGGAAGAGAGG - Intergenic
1194558269 X:95389137-95389159 CCTCTCCTCAAGTGGAAGAAAGG + Intergenic
1194591482 X:95805110-95805132 CCTCTCCTCAAGTGGAAATAAGG - Intergenic
1194595101 X:95847884-95847906 CCTCTCCTTAAGTGGAAGGAAGG - Intergenic
1194839848 X:98726698-98726720 CCTCTCTTTAAGTGGAAGAACGG + Intergenic
1194896145 X:99442728-99442750 CCTCTCAAAAATTGGAATAGAGG + Intergenic
1195154971 X:102113699-102113721 CCTCTCTTCAAGTGGAAGAAAGG + Intergenic
1195834949 X:109103342-109103364 CCTCTCTTCAAGTGGAAAAAAGG + Intergenic
1195852210 X:109295503-109295525 CCTCTCTTCAAGTGGAAAACAGG + Intergenic
1196922065 X:120594802-120594824 CCTCTCCTCAAGTGGAAAGAAGG - Intronic
1197188094 X:123610880-123610902 TCTATCATTAAGTGAAAAGGTGG + Intronic
1197727458 X:129785885-129785907 CCTCTTATTGCATGGAAAAGAGG - Intronic
1197979647 X:132201928-132201950 CCACTCCTTTAGTGGAAAAAAGG + Intergenic
1198586109 X:138124157-138124179 CTTCTCCTCAAGTGGAAAAATGG + Intergenic
1198947621 X:142031832-142031854 CCTCTCCTCAAGTGGAAAGAAGG + Intergenic
1199217978 X:145282719-145282741 CCTCTCCTTAAGTGGAAGAAAGG + Intergenic
1199652704 X:149962893-149962915 CATCACAATAAGTGGAACAGTGG - Intergenic
1200112271 X:153746980-153747002 CATCTCATTTAGGGGACAAGAGG + Intergenic
1200603315 Y:5232593-5232615 CCTCTCTTCAAGTGGAAGAAAGG + Intronic
1201686707 Y:16712751-16712773 CCTCTGACAAAGTGGAAAATTGG + Intergenic