ID: 1144040119

View in Genome Browser
Species Human (GRCh38)
Location 17:11403238-11403260
Sequence CTCAAGACTCAGATTTGATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144040115_1144040119 28 Left 1144040115 17:11403187-11403209 CCAATAAATGTACATGATTAGAA 0: 1
1: 0
2: 3
3: 48
4: 356
Right 1144040119 17:11403238-11403260 CTCAAGACTCAGATTTGATAGGG 0: 1
1: 0
2: 0
3: 10
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144040119 Original CRISPR CTCAAGACTCAGATTTGATA GGG Intronic
900732078 1:4268697-4268719 CCCAAGACTCAGGTCTGAGACGG - Intergenic
902574269 1:17367471-17367493 TTCAGGACTCAGATTTGTAAAGG - Intergenic
905657780 1:39696587-39696609 CTCAAGATTCAGATTTGCTTGGG - Intronic
909047209 1:70724964-70724986 AGCAAAACTCAGAATTGATAAGG - Intergenic
909365441 1:74815151-74815173 CTCAAGGATCAGATGTGAGATGG + Intergenic
912960548 1:114191733-114191755 CACAAGACTATGATTTGATGAGG - Intergenic
913160326 1:116139402-116139424 CTTAAAACTCAGATTTTAAAAGG + Intergenic
915236173 1:154484540-154484562 CTGATGACTCATATGTGATAAGG - Intronic
915779232 1:158527644-158527666 CACAAGATTCAGATTTCTTATGG - Intergenic
915796862 1:158744661-158744683 CTCAAGAGGCAGTTTTGACAAGG + Intergenic
916140268 1:161691040-161691062 TTCAAGAATCCAATTTGATAAGG + Intergenic
918317228 1:183332109-183332131 CTGAGGACACAGGTTTGATATGG - Intronic
918366361 1:183812317-183812339 CTCAAGACGTAGAGTTGATTTGG + Intronic
918875792 1:190041223-190041245 TTCAAGACTAAGATTTGTTGTGG + Intergenic
921543569 1:216448478-216448500 CTCAAGGGTGAGATTAGATAGGG + Intergenic
922622739 1:227002809-227002831 CTCAAGACTCAGCTGTGACTAGG - Intronic
922955733 1:229597858-229597880 CTAAAACCTCAGATTTGTTATGG + Intronic
1063887592 10:10595408-10595430 AGAATGACTCAGATTTGATAAGG + Intergenic
1064391766 10:14948344-14948366 CTCAAGATACATATTTGAAAAGG - Intronic
1065130779 10:22617833-22617855 CTCAAGACACAGATTGAAAAAGG + Intronic
1065670716 10:28113845-28113867 CTCAAGTCTCAGACTAGAAATGG + Intronic
1065764676 10:29016908-29016930 CTCAAGACACAGATGTACTAAGG - Intergenic
1066037825 10:31511395-31511417 CTGAAGACTCAATTTTTATATGG + Intronic
1066352600 10:34650580-34650602 CTCAAGACTCAGTTTTTGTCTGG - Intronic
1066551093 10:36557940-36557962 CCCAAGACTCAGAATTAATCAGG + Intergenic
1069477126 10:68744670-68744692 CCCAAGACTAAGATTTGCTTTGG - Intronic
1070222302 10:74460705-74460727 TTCAAGTCTCATATTTGTTAAGG - Intronic
1071977104 10:90966034-90966056 CCCAAGACTCAGTGTTGTTAGGG - Intergenic
1075505961 10:123022560-123022582 CTCAAATCACAGATTTGAAAAGG - Intronic
1078015012 11:7605646-7605668 CTCAAGGTACAGAGTTGATAAGG + Intronic
1078189201 11:9077621-9077643 CCCAACATTCAGATTTGAAAGGG - Intronic
1078410660 11:11114316-11114338 CTCAAGCCTCTGAGTTGAAATGG + Intergenic
1079504138 11:21134070-21134092 TTCAAGTCTCCGCTTTGATATGG + Intronic
1084754058 11:71223582-71223604 CTCAAGTCCCTGATTTAATATGG - Intronic
1086653940 11:89326237-89326259 CACAAGACTCTGTATTGATACGG - Intronic
1087715253 11:101601489-101601511 ATCTAGACTTAGATTTGAGAGGG - Intronic
1087749801 11:101994848-101994870 CTCAAGACACAGAAAAGATATGG - Intronic
1095212620 12:39510782-39510804 CTCAAGACTCAGTGGTGACAGGG - Intergenic
1097666594 12:62484675-62484697 CCCAAGACTCAAAATTCATACGG - Intronic
1098851966 12:75606394-75606416 CTCAGGACCCAGATTTCCTAAGG - Intergenic
1102344075 12:112147317-112147339 CTCAATACTCTGATTTGGTTTGG + Intronic
1107187772 13:37545064-37545086 CACAATAATCAGATTTTATAAGG - Intergenic
1115674186 14:35650765-35650787 CTCAAGATTGAGATATGACAAGG + Intronic
1116867869 14:50045846-50045868 CTCAAAACTCAGAACTGAAATGG + Intergenic
1119039609 14:71261457-71261479 TTCAAGACTCAGATCAGATATGG - Intergenic
1119600998 14:75976961-75976983 CTCAAGATTCTGATTCTATAAGG + Intronic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1124476147 15:30036689-30036711 TTCAACACTTATATTTGATACGG + Intergenic
1127666609 15:61153910-61153932 ATCAAGAAACAGATTTGGTAAGG + Intronic
1127708673 15:61573537-61573559 CTCAAGACTCAAATAGGTTAAGG + Intergenic
1128353000 15:66904016-66904038 CTCACCACTCAGAATTGTTATGG - Intergenic
1129494423 15:75964591-75964613 CTCATTACTCAGATTTCTTAAGG + Intronic
1130079230 15:80717311-80717333 CCCAAGACTCAAACTTAATATGG - Intronic
1133226658 16:4344160-4344182 CTCAAGACTGAGATGGGATTCGG + Intronic
1137767588 16:50990116-50990138 CTCAAGTCTCAGATTTGACCTGG + Intergenic
1139171167 16:64631226-64631248 CTGAAGCCTGAGATTTGAAATGG - Intergenic
1139231195 16:65284111-65284133 CTCAAGACTCTGATTAGTCAGGG - Intergenic
1140031083 16:71339913-71339935 CTCAAGACTCAGGTTTCACCAGG - Intergenic
1143448214 17:7021025-7021047 TTCAAGGCTCAGATTAGATTTGG - Intergenic
1144040119 17:11403238-11403260 CTCAAGACTCAGATTTGATAGGG + Intronic
1146276622 17:31520244-31520266 CTCAAGTCCCAGATATGAAATGG - Intronic
1155561040 18:27077502-27077524 TTCAAGACTCTGATTTAACAAGG - Intronic
1156179175 18:34582792-34582814 CTCCAGACTCACATATTATAAGG + Intronic
1159880955 18:73858135-73858157 CTCAAGACTGAGTTTTCAGAGGG - Intergenic
1161181252 19:2884205-2884227 CTTCAGACTCTGATTTGACAGGG - Intergenic
1164449411 19:28347506-28347528 CTCAAGATTCTAATTTGAAAAGG + Intergenic
1164461536 19:28453218-28453240 CTCATGTCTCAGATTGGATGCGG - Intergenic
925843214 2:8011699-8011721 CTCAAGACTCAGAATTTCTTTGG + Intergenic
927622361 2:24675454-24675476 CTCAAGATTCACATTTGAGGAGG + Intronic
928489050 2:31762223-31762245 CTCAGGACTCAGATCTCAAAGGG - Intergenic
931093275 2:58910597-58910619 CTGAAGTCTCAGATTTCACAGGG - Intergenic
932123395 2:69121790-69121812 TTCAAGCCTCAGCTTTGATTGGG - Intronic
932429740 2:71667199-71667221 CTCATGTCTCACTTTTGATAGGG - Intronic
932523782 2:72442363-72442385 CTCAAGACTCATATTCAACATGG + Intronic
933007862 2:77018433-77018455 ATCCAGACACAGATATGATATGG - Intronic
933243367 2:79947883-79947905 TTAAAGAGGCAGATTTGATAAGG + Intronic
933872812 2:86586027-86586049 CTCAAGTCTCTGATTTAAAATGG + Intronic
936816644 2:116469076-116469098 CAGTAGACCCAGATTTGATATGG + Intergenic
938091051 2:128435029-128435051 ATCAAGACCCAGAGTTGAAAAGG - Intergenic
939557254 2:143690836-143690858 CTTGAGACTCAGTTTTGGTATGG - Intronic
939765069 2:146238295-146238317 CTCCAGACTGAAATTTCATAAGG - Intergenic
941524465 2:166589466-166589488 CTCAACACTCTTATTTGATATGG - Intergenic
944324270 2:198385181-198385203 CTCAAGAATTACATTTGATGTGG - Intronic
948123852 2:235550544-235550566 CTCCAGACTCAGAGTTGATGAGG + Intronic
1170486269 20:16819295-16819317 CTCAAAACTCAGCTGTCATATGG + Intergenic
1170709965 20:18781747-18781769 CTCAAGATTCAGATTTCTTGGGG + Intergenic
1177070604 21:16501732-16501754 ATCAAGACTTACATTTGACAAGG - Intergenic
1179340262 21:40501417-40501439 CTCAAGACACAGATTGAAAAGGG - Intronic
1181961179 22:26622742-26622764 ATCAAGGCTCAGAGTTGAGAAGG + Intronic
952557261 3:34546965-34546987 CTCAAGTCTCAGATATAAAATGG - Intergenic
954239773 3:49284403-49284425 CCCAGGACTCAGATCTGCTAGGG - Intronic
954678166 3:52326954-52326976 CTCAGGAGTCAGATCTGAAAGGG + Intronic
956991631 3:74773040-74773062 CTCAAGTCTCTGATTTAAAATGG + Intergenic
957413831 3:79874916-79874938 CTGAAGAGCCAGATTTGAAATGG - Intergenic
962353110 3:134670196-134670218 CTCAAAAATCATATTTGATTTGG - Intronic
965642307 3:170842696-170842718 CTCAAGACTGCCATGTGATACGG - Intronic
970024737 4:11611312-11611334 CTGCAGACTCAGATTAGGTAAGG - Intergenic
974518339 4:62945491-62945513 CTCAAAACTAAGAAATGATAAGG + Intergenic
977176499 4:93826762-93826784 CTCAAGAAGCACATTTTATATGG + Intergenic
978103841 4:104876940-104876962 CTCAAGAGTGAGATCTGATGTGG - Intergenic
978468416 4:109034236-109034258 CTCAAGAAACACATTTGATATGG + Intronic
978565237 4:110074168-110074190 CTCAAGTCTCTGATATGAAATGG + Intronic
978908119 4:114033619-114033641 TTCAAGATTCAAATTTTATATGG + Intergenic
979854520 4:125614753-125614775 AACAAGAATCACATTTGATATGG + Intergenic
988063293 5:26202195-26202217 ATCAAAACTCACATTTGCTAGGG + Intergenic
988945571 5:36193835-36193857 CACAAGACTCAAATTGTATAAGG + Intronic
989989733 5:50747260-50747282 CTTAAGACTCAAATGTCATAAGG + Intronic
991978339 5:72205100-72205122 CTCATGACTCAGAAGTGATGAGG + Exonic
992660088 5:78950736-78950758 CTCAAGCTGCAGATTTGAGAAGG + Intronic
993610498 5:90047571-90047593 CACAATACTCAGATTTTATTTGG + Intergenic
993916295 5:93745882-93745904 CTCAAGAATCATATTAGTTAAGG + Intronic
995261306 5:110107371-110107393 CTCAGGCATCAGATGTGATAAGG - Intergenic
996343455 5:122464263-122464285 GTCAACACTGAGATTTGAGAAGG - Intergenic
996879765 5:128282913-128282935 CTCAAGACTCAAATCTCAAATGG + Intronic
997967053 5:138366278-138366300 CTCAAAACTCAGTTTAAATAGGG - Intronic
1000196824 5:158967489-158967511 CTCAAGAGCCAGTTTTGATAGGG - Intronic
1001209968 5:169801564-169801586 CTCAAGATTCAGATTTCAGGAGG + Intronic
1003853411 6:10247950-10247972 CTGTAGACTAAAATTTGATAAGG + Intergenic
1005388555 6:25310330-25310352 CTCAAGCCGCAGCTTGGATATGG - Intronic
1010505147 6:76648091-76648113 CTTAAAACAAAGATTTGATATGG - Intergenic
1010730215 6:79382863-79382885 TCCAAGACTCAGATATGCTATGG + Intergenic
1011731399 6:90267714-90267736 CACTAGATTCATATTTGATAAGG + Intronic
1011816661 6:91199305-91199327 CTCGAGTCTCAGATTAGATTTGG - Intergenic
1012687052 6:102264477-102264499 CTTAAGACCCATATTTGATCTGG + Intergenic
1014248612 6:119093836-119093858 CTAAAGTCACAGCTTTGATAGGG - Intronic
1016231553 6:141811713-141811735 CTCCTGTCTCAGATTTGATTTGG - Intergenic
1017293070 6:152763732-152763754 GTCAAAACCCAGATTTGCTAGGG + Intergenic
1019964226 7:4485643-4485665 AAAAAGACTCAGATTTGAAAAGG - Intergenic
1021221203 7:17977018-17977040 ATTAAAACTCAGATTTGATCAGG + Intergenic
1022636785 7:32143666-32143688 CTCAAGACTCACATTTTAAAGGG + Intronic
1025933249 7:66013173-66013195 TTCAAGACCCAGCTTAGATAGGG - Intergenic
1027378217 7:77575726-77575748 CTGAAGACTCAGATCTTTTAGGG - Intronic
1029118362 7:98249950-98249972 CTGAAGACTCAGACCTGAAAGGG - Intronic
1029953350 7:104610575-104610597 CTTCAGACTCAGATTTGAACTGG - Intronic
1037053389 8:14405099-14405121 CCCCAGACTCAAATTTGGTAAGG + Intronic
1038118463 8:24584479-24584501 CTCAAGACTAAGATAAGATATGG - Intergenic
1040093698 8:43422096-43422118 CTCAAGAATCAGCTTTGCTGAGG + Intergenic
1040400067 8:47041277-47041299 CTCAAGAATCAGCTTTGCTCAGG - Intergenic
1042336602 8:67636020-67636042 ATCGAGACTCAGTTCTGATATGG - Intronic
1043639294 8:82430881-82430903 CTCAATACTAAGGTTTGACAAGG - Intergenic
1045272466 8:100673779-100673801 ATCAAGACTCAGAGCTGAAAGGG - Intergenic
1050089444 9:2002065-2002087 CTCAAGCATCAGAATGGATAAGG + Intergenic
1052772500 9:32702748-32702770 CTCAAAACTCAGATTTGGAAAGG + Intergenic
1053151025 9:35743090-35743112 CTCAAGTCTTTGATTTGAAATGG - Intronic
1058281563 9:103122366-103122388 AACTAGACTCAGATATGATAGGG + Intergenic
1186449776 X:9662368-9662390 ATCATGACTCAGCTTTGAAAAGG + Intronic
1188120323 X:26298162-26298184 CTCAAGACTAACATGTGCTAAGG + Intergenic
1188543866 X:31280222-31280244 CTCAAAAGTAAGATTTTATAAGG + Intronic
1193130375 X:77913496-77913518 CTGAAGACTGAGATTTAAGAGGG - Intronic
1195384353 X:104299704-104299726 CTCTTGACTCAGATTTTGTAGGG - Intergenic
1200184602 X:154174114-154174136 CGAAAGACTCGGATTTGAGAGGG + Intergenic
1200190255 X:154211252-154211274 CGAAAGACTCGGATTTGACAGGG + Intergenic
1200196006 X:154249054-154249076 CGAAAGACTCGGATTTGAGAGGG + Intergenic
1200201661 X:154286172-154286194 CGAAAGACTCGGATTTGAGAGGG + Intronic