ID: 1144040458

View in Genome Browser
Species Human (GRCh38)
Location 17:11405864-11405886
Sequence GCTGAATCACAGACCGACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 62}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144040458_1144040459 3 Left 1144040458 17:11405864-11405886 CCAGAGTCGGTCTGTGATTCAGC 0: 1
1: 0
2: 0
3: 5
4: 62
Right 1144040459 17:11405890-11405912 TCAACTCCAAACCCAACCACAGG 0: 1
1: 1
2: 3
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144040458 Original CRISPR GCTGAATCACAGACCGACTC TGG (reversed) Intronic
902806950 1:18867083-18867105 GCTGAATCACATCCCCTCTCTGG - Intronic
906651044 1:47513104-47513126 CCTGAATCCCTGACCCACTCTGG - Intergenic
907930209 1:58992106-58992128 GCTGAATCACAAACTTACTGTGG - Intergenic
912474472 1:109926945-109926967 GCTGACTCACGGACTGACCCTGG + Intronic
915007638 1:152655086-152655108 GCTGGATCACAGACTGAATTAGG + Intergenic
1066275293 10:33862837-33862859 TTTGAAACACAAACCGACTCAGG + Intergenic
1066481796 10:35803230-35803252 GCAGAATACCAGACAGACTCAGG - Intergenic
1068503137 10:57865284-57865306 GCTGAAACACAGACAGCATCAGG + Intergenic
1071843221 10:89494740-89494762 GCAGAATCCCAGAAAGACTCAGG + Intronic
1075528233 10:123203550-123203572 CCTGATTCCAAGACCGACTCTGG - Intergenic
1077671830 11:4164896-4164918 GCTGAATTAGAGACCTCCTCTGG - Intergenic
1078056157 11:8010491-8010513 GCTGTACCACACACCCACTCAGG - Intergenic
1088797212 11:113274096-113274118 ACTGAATAACACACCGACTGGGG - Intronic
1089075091 11:115732030-115732052 GGTGAAGCAGAGACCAACTCTGG - Intergenic
1089418994 11:118316771-118316793 GCTTAACCACAGCCCGCCTCTGG - Intergenic
1091990871 12:4954877-4954899 GCAGAATCACAGACCCTCTAAGG + Intergenic
1092260444 12:6950819-6950841 GCTGACTCACTGATGGACTCAGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1096846956 12:54412594-54412616 GCTGAAACACAGACCCAGCCAGG - Intronic
1100207237 12:92363924-92363946 GCTGAATCAGGGAGCGACTCTGG - Intergenic
1100765028 12:97854482-97854504 GCTGAATGACAGACTGCATCTGG + Intergenic
1106219022 13:27729400-27729422 GCTGAATCACCTTCCGACTTGGG - Intergenic
1114673482 14:24427105-24427127 GCTGGATCCCAGATGGACTCTGG - Exonic
1120980021 14:90280999-90281021 GCCGAATCACACACTCACTCGGG - Intronic
1120983966 14:90316295-90316317 ACTGACTCACAGACCCACTGTGG + Intronic
1132783673 16:1642473-1642495 GCTGTACCCCAGACCCACTCTGG - Intronic
1142309743 16:89305524-89305546 GCTGAGCCACAGCCCGACCCCGG - Intronic
1142312526 16:89322449-89322471 GCTGAATCACATCCCTTCTCAGG - Intronic
1144040458 17:11405864-11405886 GCTGAATCACAGACCGACTCTGG - Intronic
1152334579 17:79693222-79693244 GCTGAGTCCCAGAGCGACTGGGG + Intergenic
1155044639 18:22093282-22093304 ACTGAATTTCAGACCGAGTCTGG - Intronic
1166979657 19:46625073-46625095 GCTGACACACAGACCGACACAGG - Exonic
941095708 2:161238027-161238049 GCCGAAGCACGGCCCGACTCGGG - Intergenic
948202650 2:236141077-236141099 GCTGAGCCACAGACCAGCTCTGG - Intergenic
948729489 2:239953956-239953978 GCTGAGTGACCGACCGCCTCGGG + Intronic
1175246916 20:57587763-57587785 GCTGAATCTCAGACAGACTGAGG + Intergenic
1179122322 21:38559422-38559444 GCAGAATTAAAGACCAACTCTGG + Intronic
1182646617 22:31815221-31815243 GCTGAAGCACAGACAGAGCCAGG + Intronic
1182832156 22:33313079-33313101 GCTGGATCACAGAGGGCCTCAGG - Intronic
1184415673 22:44350560-44350582 TCTGAACCACAGACTGACTTAGG - Intergenic
1185269027 22:49919708-49919730 GCTGAAACACAGGCCCACACCGG - Exonic
1185299323 22:50071436-50071458 GCTCAATGGCAGACCGAATCCGG - Intronic
952465163 3:33576609-33576631 GCTGAATCACAGAGTAACCCAGG + Intronic
960026014 3:113010642-113010664 GCTGAAACACAAAGCTACTCAGG - Exonic
966068237 3:175842408-175842430 GCTAAATCCTAGACCAACTCTGG + Intergenic
966300656 3:178475914-178475936 GCTGACTCACAGTATGACTCTGG - Intronic
967135522 3:186509711-186509733 GCTGAATCACAGACAGAGGCTGG - Intergenic
968079269 3:195835270-195835292 GCGGAATCAGAGACCCACCCAGG - Intergenic
968403386 4:317540-317562 GCTCAACCACAGACTGACTGCGG + Intergenic
969530942 4:7729825-7729847 GCTGCATCTCAGTCTGACTCAGG + Intronic
985107324 4:186511642-186511664 GCTGCGTCACAGCCCCACTCAGG - Intronic
987297947 5:16570692-16570714 ACTGATCCACAGACCAACTCTGG + Intronic
993852844 5:93032820-93032842 GCTTAATCACAGACTTTCTCTGG + Intergenic
995805659 5:116049297-116049319 TCTGAATCTCAGACCTACTGAGG - Intronic
1001534150 5:172486817-172486839 GCTGACTCACAGACAGACTTGGG + Intergenic
1004116107 6:12769723-12769745 GAAGAGTCACAGACAGACTCGGG + Intronic
1009797641 6:68492449-68492471 GCTGAATCACACATCCACACAGG - Intergenic
1015547199 6:134373618-134373640 GCTGACTCACAGTCAGCCTCTGG + Intergenic
1018690912 6:166343089-166343111 GCTGTATTTCAGACCGTCTCAGG + Intergenic
1024776305 7:52790651-52790673 GCTGAAGCATAGATTGACTCAGG + Intergenic
1027537478 7:79422753-79422775 GCAAAAACACAGCCCGACTCTGG + Intronic
1032705717 7:134419797-134419819 GTTGAATGAGAGGCCGACTCTGG - Intergenic
1047990368 8:130279968-130279990 GCTGAATGAGACACAGACTCAGG - Intronic
1054747709 9:68871573-68871595 GTTCAATCACAGACCAGCTCTGG - Intronic
1056148414 9:83758758-83758780 ACTGAATGACAGACAGACTTAGG + Intronic
1058897698 9:109414324-109414346 GCAGAATCTCAGACCCACACAGG - Intronic
1061712098 9:132495314-132495336 GGGGAATGACAGACAGACTCAGG - Intronic
1062160631 9:135077688-135077710 GCTGAACCACAGGCTGTCTCAGG + Intronic