ID: 1144040618

View in Genome Browser
Species Human (GRCh38)
Location 17:11407440-11407462
Sequence AATAAGATAGAGAACCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 222}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144040618 Original CRISPR AATAAGATAGAGAACCCTGA TGG (reversed) Intronic
903362572 1:22786025-22786047 AATATGGTAAAGAACCATGAAGG + Intronic
906991201 1:50741161-50741183 AATTAGATACAGAAGCCTGTTGG + Intronic
907077434 1:51591420-51591442 ACTAAGATAGAGAACACCGGGGG + Intronic
907279463 1:53337002-53337024 AATAAGGTAGTGAACCCAGAAGG - Intergenic
908499000 1:64724117-64724139 AAAGAGAAAGGGAACCCTGAGGG - Intergenic
909376151 1:74944365-74944387 ATTAAGAGAGAGATCCATGAAGG + Intergenic
909512408 1:76469395-76469417 AATTAAATTCAGAACCCTGAGGG + Intronic
913072756 1:115315523-115315545 ACTGAGATGGAGAACACTGAAGG + Intronic
913357927 1:117944621-117944643 ATTAAGATAGGGAAGTCTGAAGG - Intronic
913669401 1:121081711-121081733 CATGTGATAGAGAACCCAGAAGG - Intergenic
914021156 1:143869110-143869132 CATGTGATAGAGAACCCAGAAGG - Intergenic
914659646 1:149777034-149777056 CATGTGATAGAGAACCCAGAAGG - Intergenic
915350467 1:155221780-155221802 AATAAAATAGAAAATCCTCAAGG - Intergenic
917140303 1:171828516-171828538 AATAAGAGAGAGAAGCAAGAGGG + Intergenic
917158903 1:172035204-172035226 ACCAAGATGGGGAACCCTGAAGG + Intronic
920099853 1:203510284-203510306 AAAAAGAAAGAAATCCCTGAAGG + Intergenic
923428892 1:233901070-233901092 AATAACATGGATAAGCCTGAAGG + Intergenic
1063263432 10:4416927-4416949 AATAAGGTGGAGAAGCCAGAAGG - Intergenic
1064587465 10:16852566-16852588 AATAAGAAGGAGACACCTGAAGG - Intronic
1064806208 10:19136934-19136956 GTTAAAATAGAGATCCCTGAAGG - Intronic
1065346243 10:24750392-24750414 AAAAAGATAGGGCAACCTGAGGG - Intergenic
1066569116 10:36752436-36752458 CATAAGATCGTGAACCCTGGGGG - Intergenic
1067107500 10:43375850-43375872 ATTCAGATAGTCAACCCTGAAGG + Intronic
1067902738 10:50259118-50259140 GTTAAGCTAGAGAACTCTGAGGG - Intergenic
1069985194 10:72278194-72278216 AATAAGAGAGGGAATCCTGTAGG - Intergenic
1071597178 10:86936781-86936803 AATAACAAAGAGAAGCCTGTCGG - Exonic
1071617704 10:87091807-87091829 AATGAGATACAGAAAGCTGAAGG + Intronic
1072239040 10:93478087-93478109 CATAAGATAAACAACCCAGAAGG - Intronic
1073859455 10:107721126-107721148 AAGTACATAGAGACCCCTGATGG + Intergenic
1077625320 11:3766387-3766409 AATAAAATTGAGAAACATGAAGG + Intronic
1077625368 11:3766704-3766726 AAAAAAAGAGAGAAGCCTGAGGG + Intronic
1078052541 11:7979673-7979695 AATAAGTTTGTGAAACCTGATGG - Intronic
1078834518 11:15014452-15014474 AATCTGATAGAAAACTCTGATGG - Intronic
1078860728 11:15243851-15243873 AATAAAAGAGAGAGCCCTTAGGG - Intronic
1079358802 11:19753321-19753343 AATAAGATAAAGAGGCTTGAGGG - Intronic
1079669601 11:23151083-23151105 AATCAGATACAGGACCCTGTGGG - Intergenic
1079763496 11:24359138-24359160 AATAAAATAAAGTATCCTGAGGG + Intergenic
1080134878 11:28843015-28843037 ACTAAAATAGAGAACACTGGAGG - Intergenic
1081072397 11:38627961-38627983 AATAGTATGGAGAACACTGATGG + Intergenic
1082956722 11:58877690-58877712 AATAACATAGAGATCACTGATGG + Intronic
1082963623 11:58942973-58942995 AATAACACAGAGATCCCTGATGG + Intronic
1082972705 11:59040500-59040522 AATAACATAGAGATCACTGATGG + Intronic
1082977163 11:59084397-59084419 AATAACATAGAGATCACTGATGG + Intergenic
1085946858 11:81283026-81283048 AATAAGATCAAGGTCCCTGAAGG - Intergenic
1086476958 11:87187072-87187094 AATAAGTTTGAGAACCCAGTAGG - Intronic
1087663070 11:101010336-101010358 AAGAAGAAAGAGAACACTTAGGG + Intergenic
1089989988 11:122850178-122850200 AAAAAAATGGTGAACCCTGAGGG - Exonic
1090325903 11:125886498-125886520 ACTAGGATATTGAACCCTGAGGG + Intronic
1091331486 11:134734732-134734754 AATAAGATAAAGAAGTCTGGGGG - Intergenic
1092026298 12:5243574-5243596 AATAAGCAAGGGAACCCTGCAGG + Intergenic
1093401108 12:18747493-18747515 AGTTAGCTAGAGAGCCCTGACGG - Intergenic
1095271959 12:40229168-40229190 AATAATATAAAGAAATCTGAAGG - Intronic
1096435175 12:51584025-51584047 AACAACATAGATAAACCTGAAGG - Intergenic
1098419542 12:70279435-70279457 AATAAGCCAGAGAAAACTGAGGG + Intronic
1098930088 12:76401388-76401410 AATAAGAGAGCTAACCCTGAGGG + Intronic
1100051574 12:90455678-90455700 AATAAAAAAGAGCACCATGATGG - Intergenic
1100059275 12:90553016-90553038 AAAAAGAGAGATTACCCTGATGG + Intergenic
1100368022 12:93939454-93939476 GATAAGACAGAGAGCTCTGAGGG + Intergenic
1102936195 12:116899103-116899125 AATCAGAAAGAGAAGCCTGAAGG + Intergenic
1104189956 12:126471236-126471258 AATTAGATTGGGAACTCTGAAGG + Intergenic
1105349599 13:19603065-19603087 ATTAAGATAGAAAACCATGATGG - Intergenic
1106703330 13:32253204-32253226 CATGAGATAAAGAGCCCTGAGGG - Intronic
1106968429 13:35103689-35103711 AATAAGATAAAGAACTCTGAAGG - Intronic
1107758178 13:43648468-43648490 GATGAGATAGAGAACACAGAGGG + Intronic
1108983921 13:56558305-56558327 GAGAAGATAGAGAACCCTCCAGG + Intergenic
1109084874 13:57957403-57957425 AATAACTTAGAAAACGCTGAAGG + Intergenic
1111300610 13:86344781-86344803 AATAAGATAGATGAATCTGAAGG + Intergenic
1111703576 13:91720744-91720766 AATGAGATAGAGAAGACTAAAGG - Intronic
1112639896 13:101261187-101261209 AACAGAATAGAGAACCCAGAAGG - Intronic
1114457642 14:22866975-22866997 GAAAAGAAAAAGAACCCTGAAGG - Intergenic
1115430208 14:33308623-33308645 AATAAAATATATATCCCTGAAGG - Intronic
1117985775 14:61384827-61384849 AACAACATAGAGAACCCTAAAGG + Intronic
1120051628 14:79873875-79873897 AAGAAAATAGAGAACTCTGGGGG - Intergenic
1121880770 14:97498543-97498565 AAGTAGATAGAGAACAGTGATGG - Intergenic
1123484556 15:20676875-20676897 AATAAGACAAACAACTCTGAAGG + Intergenic
1123537284 15:21245940-21245962 AATAAGACAAACAACTCTGAAGG + Intergenic
1128842308 15:70860100-70860122 AAGAAGATTGAGACCCGTGATGG + Intronic
1130626109 15:85517214-85517236 AATGAGATAGAAAGCCCTGTAGG - Intronic
1136347257 16:29684104-29684126 AATAAGATAAAGAACCCACAGGG - Intronic
1138117082 16:54369428-54369450 AAAAAGAGAGAGAAGCCTGAAGG + Intergenic
1140253259 16:73313486-73313508 AATAAGAGAGACATCCCTTAGGG - Intergenic
1140617486 16:76683716-76683738 AATAAATTAGAAAACCCAGAAGG - Intergenic
1140795817 16:78436561-78436583 CCTAATATAGAGAACGCTGATGG - Intronic
1141336610 16:83161689-83161711 GATAAGAAAGAGAACCATGGTGG - Intronic
1141366054 16:83444307-83444329 AATAAGATAATGAACACTCAGGG - Intronic
1142295550 16:89219277-89219299 AATATGATAGAGAAACCACAGGG - Intronic
1143787845 17:9269590-9269612 AGTAAGATAGACAACCCAAAAGG + Intronic
1144040618 17:11407440-11407462 AATAAGATAGAGAACCCTGATGG - Intronic
1144402360 17:14918516-14918538 AAGCAGATAAAGAACTCTGAGGG - Intergenic
1149164088 17:53728779-53728801 AAAAAGAAGGAGAACCCTGAAGG + Intergenic
1149450629 17:56747521-56747543 AAGAAGATAAAGAACACTTAAGG - Intergenic
1150947859 17:69766346-69766368 AAAAAAAAAGAGAGCCCTGAGGG - Intergenic
1151112389 17:71694193-71694215 GATGAGATAGATAACACTGAGGG + Intergenic
1152096714 17:78276854-78276876 AAAAAGATAAATACCCCTGATGG - Intergenic
1153552614 18:6277456-6277478 AACAGGATAGAGAAACCAGAAGG - Intronic
1154107863 18:11539490-11539512 AATTAGATATAGAATGCTGAGGG + Intergenic
1156646651 18:39170514-39170536 ACGAAGAGAGAGAAGCCTGAGGG - Intergenic
1156941641 18:42774359-42774381 AAGAAGACAGAAAACCATGAGGG + Intronic
1157702208 18:49768794-49768816 ACTAAGATAGAGAAAGCTGCAGG - Intergenic
1158257333 18:55566620-55566642 AACACGTTAGAGAAACCTGAAGG + Intronic
1158897752 18:61931185-61931207 AATAAGAAAGAAAACCCCTAGGG - Intergenic
1159471448 18:68861750-68861772 CATCAGAGAGAGAACCCTGGGGG - Intronic
925589266 2:5493668-5493690 GAGAACAAAGAGAACCCTGAGGG + Intergenic
925937194 2:8775641-8775663 AATAAGTTAGAGAAAACAGAGGG + Intronic
926443276 2:12912451-12912473 AAATACATTGAGAACCCTGAAGG + Intergenic
927959671 2:27233327-27233349 TATGAGCTCGAGAACCCTGAAGG + Exonic
928307499 2:30182435-30182457 AATAAAATAAAAATCCCTGACGG - Intergenic
930551538 2:52840864-52840886 AATCAGAAAGAGCACCTTGAGGG - Intergenic
930831643 2:55750032-55750054 AAAAAGAGAGAAAACCCTCATGG + Intergenic
932856647 2:75241196-75241218 AAGAAGATAGAGAGCCCTATGGG - Intergenic
938576302 2:132607524-132607546 TATAATTTAGAGAACCTTGAGGG + Intronic
938807294 2:134818151-134818173 AATAACATCAAGAACCCTGCAGG + Intergenic
939582607 2:143968318-143968340 AGTTAGACAGAGATCCCTGAGGG + Intronic
939723090 2:145679543-145679565 AATAAAATTCATAACCCTGAAGG - Intergenic
942609555 2:177728722-177728744 AATAAAATAGAGATATCTGAAGG + Intronic
942893892 2:181026420-181026442 AACAAGATAGAGAAACCAGCAGG - Intronic
943064373 2:183071080-183071102 AAGAAGATTGAGACCCGTGATGG - Intergenic
947659991 2:231859454-231859476 AATCAGATAGGGAACCCACAGGG - Intergenic
948161962 2:235832309-235832331 AATAAGCTGGAGAACCTTGAAGG - Intronic
1170273584 20:14556242-14556264 TATAAGGGAGAGAACCCGGAAGG - Intronic
1173326643 20:42039619-42039641 AATAACATAGATGAACCTGAAGG - Intergenic
1173849661 20:46210051-46210073 AATAAGGGAGAGAACCAGGAGGG - Intronic
1179251626 21:39675484-39675506 AAGAAAATAGAGCACACTGAAGG - Intergenic
1180944289 22:19681227-19681249 AAAAAAATAGAGAAGACTGATGG + Intergenic
1181402793 22:22661457-22661479 AATCACTTAGAGATCCCTGAAGG - Intergenic
1181675912 22:24451857-24451879 AATAAGTTAAAGAACACTAAAGG + Intergenic
1183731609 22:39621665-39621687 AATACGATAGAAAACGCTGGGGG + Intronic
1184180194 22:42816616-42816638 AATAAGATAGTGAGTGCTGAAGG + Intronic
1184375685 22:44111083-44111105 AAAAACACAGAGAAGCCTGAAGG - Intronic
1203295529 22_KI270736v1_random:39782-39804 AATAAGATAGAGGCAGCTGAAGG - Intergenic
950757066 3:15183619-15183641 ATTACGATGGAGAAGCCTGATGG + Intergenic
951842038 3:27044672-27044694 AATAAGTTAGAGAACCGAGAAGG + Intergenic
952941986 3:38452781-38452803 AAGAAGATGCAAAACCCTGAGGG + Intergenic
953266289 3:41392308-41392330 AATAAGAAAGAGCACCCTAGAGG + Intronic
953728609 3:45425102-45425124 AATAAGATAGAAAAACAAGAAGG - Intronic
954381847 3:50223226-50223248 GATAAGTTAGAGCAGCCTGAAGG + Intergenic
955705697 3:61725531-61725553 AACAGAATAGAGAACCCAGAAGG - Intronic
956640289 3:71409153-71409175 AAAAAGATAGTGAGACCTGAGGG - Intronic
956860739 3:73321317-73321339 AATAAGATAGAGCAACTTGTAGG + Intergenic
959344085 3:105171027-105171049 AAAAAGAGAGAGAGCTCTGAAGG + Intergenic
962006047 3:131351251-131351273 AGGAAGACAGAGAAACCTGAGGG + Intergenic
962616393 3:137130885-137130907 AATAAGCTGGAGAAGCCAGAGGG + Intergenic
962736971 3:138333991-138334013 AATAGACTAGAGAATCCTGAAGG - Intergenic
962994846 3:140615834-140615856 AAGAAGAAAGTGAACCCTGCAGG + Intergenic
966005541 3:175007370-175007392 ACTTAGGTAGAAAACCCTGAAGG + Intronic
967446960 3:189578059-189578081 AAGAAGATAGGGACACCTGAAGG - Intergenic
967518519 3:190400200-190400222 AATAAGACAGAGGATACTGAAGG - Intronic
970145145 4:13028245-13028267 AATAAAATAGAGAAACATGTTGG - Intergenic
972282257 4:37613767-37613789 AATACAATCCAGAACCCTGAAGG - Intronic
973013198 4:45103378-45103400 AAAAAGATAGAGAAGCCTTTAGG - Intergenic
973030588 4:45332446-45332468 GAAAAGAGAGAGAAGCCTGAAGG + Intergenic
974715222 4:65660776-65660798 ATTAAGATACAGGACCCTCAAGG + Intronic
977928611 4:102728786-102728808 AAGAAGATCGAGACCCATGATGG - Intronic
977928847 4:102730203-102730225 AACCAGATAGAGATCCCAGAAGG + Intronic
977975378 4:103258519-103258541 ACTAAGATAGAGAACACAGGAGG - Intergenic
979058586 4:116026235-116026257 AATATTATAGAAAACCATGATGG + Intergenic
979554923 4:122034786-122034808 ACTAAGATGGAGAACACTGGAGG - Intergenic
979591449 4:122485018-122485040 AATCAGATATAGGACTCTGATGG - Intergenic
980029933 4:127815604-127815626 AAAAAGATAAAGAACCCAAATGG - Intronic
980739680 4:136932999-136933021 AACAATATAGATAAACCTGAAGG + Intergenic
985220525 4:187698747-187698769 AATAAGATAGACACCTGTGAAGG + Intergenic
985578852 5:686184-686206 AATAAAATAGAGATCCCGGCTGG + Intronic
987129004 5:14843162-14843184 AAAAAAAAAGAGAACCCTGGTGG - Intronic
988824090 5:34917041-34917063 AATAAGATAAAGAATCATGAAGG + Intronic
989378591 5:40791509-40791531 AATTAGATATATAATCCTGAAGG + Intronic
989756866 5:44966036-44966058 AGTAACATAGATTACCCTGATGG + Intergenic
993405239 5:87503556-87503578 AATAAAAATGAGTACCCTGATGG - Intergenic
993927849 5:93893300-93893322 AATAAGATATAGATTCCTGCTGG - Intronic
994002596 5:94798078-94798100 AATCAAATAGAGATCCTTGATGG + Intronic
994997399 5:107081590-107081612 GATAAGATAGAGGAGGCTGAGGG - Intergenic
995054346 5:107742874-107742896 AAGATGAATGAGAACCCTGAAGG + Intergenic
995292517 5:110473837-110473859 AATAACATAGATAAACCTGGAGG + Intronic
995304616 5:110630918-110630940 AGTGAGCTAGAGACCCCTGAAGG + Intronic
995922469 5:117330426-117330448 AATAAGCTGGAGAACCAGGAAGG - Intergenic
998878017 5:146619807-146619829 AAAAAGACAGTGAGCCCTGAAGG - Intronic
998889955 5:146735367-146735389 AAACAGACAGAGAACCCTGAGGG + Intronic
998956722 5:147446315-147446337 AATAAGGAAGCGAACCCTGGAGG - Intronic
999476903 5:151908408-151908430 AATAAGGTAGAGAAACCAGAAGG - Intronic
999881723 5:155871900-155871922 AAAAAGATAGAGAAGCATGGAGG + Intronic
1000744168 5:165010586-165010608 AATAATATAGGCAACCCTTATGG + Intergenic
1001021040 5:168182812-168182834 AAAAAAAAAGAGCACCCTGAAGG - Intronic
1002432889 5:179213382-179213404 TCTCAGATAGAGAACCCTGGGGG + Intronic
1003210596 6:4061360-4061382 AATAAGAAACAGTACACTGAAGG - Exonic
1003848559 6:10198888-10198910 AGTAGGATAGAGTAGCCTGAGGG - Intronic
1004830164 6:19468229-19468251 AATCAGAGAGAGAACTCTGGAGG - Intergenic
1004860061 6:19794777-19794799 AATGAGATGGAGAACACAGAAGG + Intergenic
1005235415 6:23756311-23756333 AAAATAATAGAGAACCCTTATGG - Intergenic
1007554629 6:42755607-42755629 AAGAGGACAGAGAACCCTGGTGG - Intronic
1009442586 6:63699583-63699605 AAAAAGATAAAAAAACCTGAGGG - Intronic
1010494964 6:76522788-76522810 ATTTAGGTAGAAAACCCTGATGG - Intergenic
1012074411 6:94666595-94666617 AATAAAATCAAGAACTCTGATGG + Intergenic
1012124083 6:95405348-95405370 TGTAAGATGGAGAACCCTGTAGG - Intergenic
1012331645 6:97997659-97997681 AAGAAGAGAGAGATCACTGAGGG - Intergenic
1013480864 6:110551460-110551482 AATAGGAGAGAGAACCCTGTTGG + Intergenic
1015248145 6:131098446-131098468 AAAAAGAAAGAAAAACCTGAAGG - Intergenic
1015807456 6:137125533-137125555 AATAAAAAAGATAACCCTAAAGG + Intergenic
1017497158 6:154993138-154993160 AAAAATATATAGAACCCAGATGG - Intronic
1018402989 6:163444800-163444822 AAAAAGATAAAGAAAACTGAGGG - Intronic
1019946269 7:4331648-4331670 AATGAGAGACAGAACCCTTATGG + Intergenic
1023107786 7:36779659-36779681 AATAAGATTGAGAACTCTTTTGG + Intergenic
1023479320 7:40616008-40616030 AAAAATATAGAGACCTCTGAGGG - Intronic
1023680336 7:42679345-42679367 AATCAGATAAAGAACACAGAAGG + Intergenic
1027807218 7:82843250-82843272 AACAAGATGGATAAACCTGAAGG + Intronic
1030461557 7:109843004-109843026 AATAATATGGAAAAGCCTGAAGG - Intergenic
1032988954 7:137369547-137369569 AAAAAGATAGAGGACAATGATGG - Intergenic
1034561186 7:151880208-151880230 ATTCATATATAGAACCCTGAAGG - Intergenic
1037074924 8:14702602-14702624 ATTAAGATGCAGAACACTGAAGG - Intronic
1038132956 8:24754038-24754060 AACAAGATTGAAAACCCTGCAGG + Intergenic
1039576724 8:38629553-38629575 AATGAGATAGAGAAGCCTGGGGG + Intergenic
1039976328 8:42368810-42368832 AATACTATAGAAAACCCTCAGGG - Intronic
1040417855 8:47211505-47211527 AATCAGCTATAGGACCCTGATGG - Intergenic
1041948437 8:63473485-63473507 CATTAGATAAAGCACCCTGAAGG - Intergenic
1042008729 8:64213749-64213771 AATAAGATAGACAACACTCTGGG + Intergenic
1043019354 8:74982158-74982180 AAGAAGACAGACAAGCCTGAGGG - Intergenic
1043378033 8:79671648-79671670 AAGCAGAGAGAGAATCCTGAGGG + Intergenic
1045233286 8:100326649-100326671 AATAAGATAGAGAAACTTGAAGG - Intronic
1046807096 8:118490937-118490959 AAAAAAAAAAAGAACCCTGATGG + Intronic
1046809836 8:118520948-118520970 AATAAGATTGACAAGACTGATGG - Intronic
1048718124 8:137291210-137291232 ACTGAGATAGAGAAGACTGAAGG - Intergenic
1049971000 9:821912-821934 AATGAGAAAGAGAATTCTGAGGG + Intergenic
1050683366 9:8139705-8139727 AATAAGACACATAATCCTGATGG - Intergenic
1052648089 9:31264073-31264095 AACAAGATTGAGGACCCTAATGG - Intergenic
1055149473 9:72978512-72978534 ATGGAGAAAGAGAACCCTGATGG - Intronic
1055522746 9:77098047-77098069 ATTAAGATAGAGTACACTTACGG - Intergenic
1055986355 9:82059223-82059245 AATAGGCTTGAGGACCCTGAGGG + Intergenic
1058654296 9:107205951-107205973 AAAAAGGTAGAGAGCCCTGAAGG + Intergenic
1058716521 9:107727179-107727201 AATAATAAAGAAAACACTGAGGG + Intergenic
1059511235 9:114849720-114849742 AATAAGAAACAGTACACTGAAGG - Intergenic
1186404813 X:9292653-9292675 GATAAGAGAGAGAACCCATAGGG - Intergenic
1187705959 X:22009692-22009714 AACAGAATAGAGAACCCAGATGG + Intergenic
1187734657 X:22291440-22291462 AAGGAGATAGAGAATCCTGGGGG + Intergenic
1189893715 X:45632327-45632349 AAGAAGATCGAGACCCGTGATGG - Intergenic
1190565587 X:51727264-51727286 AAAAAGATACAGAACACTCAAGG - Intergenic
1190608258 X:52167374-52167396 ACTATGGAAGAGAACCCTGATGG + Intergenic
1191219724 X:57975486-57975508 AATCACACAGAGAACTCTGATGG - Intergenic
1191848795 X:65570406-65570428 AAAAAGAGAGGAAACCCTGACGG + Intergenic
1192863170 X:75100622-75100644 AATAAGGCAAAGGACCCTGATGG - Intronic
1192891284 X:75393577-75393599 AATAGTATGGAGAACACTGATGG - Intronic
1193471794 X:81913614-81913636 AATAAGAGGGAGTAACCTGAAGG - Intergenic
1194193863 X:90868847-90868869 ACTAAGATAGAGAAGCTGGAAGG + Intergenic
1194418559 X:93644098-93644120 ATTAAGATAGAGAAGAGTGATGG + Intergenic
1195769372 X:108333152-108333174 AATAGAATAGAGAACCCAGAAGG - Intronic
1195889861 X:109681054-109681076 AATAAAGCAGAGTACCCTGAAGG - Exonic
1196647142 X:118130265-118130287 AATGAGATGCTGAACCCTGAAGG - Intergenic
1197515014 X:127416306-127416328 ATTGAGATAGAGAACACAGAAGG + Intergenic
1200540473 Y:4451231-4451253 ACTAAGATAGAGAAGCTGGAAGG + Intergenic