ID: 1144044989

View in Genome Browser
Species Human (GRCh38)
Location 17:11447438-11447460
Sequence CCCCCACAGCTTCCCGGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 164}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144044985_1144044989 -10 Left 1144044985 17:11447425-11447447 CCTCAGAGAAGACCCCCCACAGC 0: 1
1: 1
2: 8
3: 79
4: 321
Right 1144044989 17:11447438-11447460 CCCCCACAGCTTCCCGGAACTGG 0: 1
1: 0
2: 0
3: 15
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144044989 Original CRISPR CCCCCACAGCTTCCCGGAAC TGG Intronic
900541905 1:3207086-3207108 CCCCCAAAGCTCCCCGCACCAGG - Intronic
901204292 1:7485047-7485069 TCCCCAGAGCTGCCCGGACCTGG + Intronic
902368806 1:15993102-15993124 CCCCGACAGCTTCCCACCACAGG + Intergenic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
905309963 1:37042497-37042519 CTCCCAGAGCTACCCAGAACTGG + Intergenic
905928668 1:41770817-41770839 GCACAACAGCATCCCGGAACAGG - Intronic
906130559 1:43453078-43453100 CTCCCACAGCTTCCTGGAATAGG + Intronic
909467686 1:75991646-75991668 CCCTCACAGTTTTCCTGAACAGG + Intergenic
909922708 1:81401420-81401442 CCACCACATCTTCCCGCAGCTGG - Intronic
913586124 1:120277486-120277508 CCCCAAGAGCTTCCAGGAAAGGG - Intergenic
913622062 1:120620883-120620905 CCCCAAGAGCTTCCAGGAAAGGG + Intergenic
914568133 1:148889344-148889366 CCCCAAGAGCTTCCAGGAAAGGG - Intronic
914604691 1:149240905-149240927 CCCCAAGAGCTTCCAGGAAAGGG + Intergenic
918378329 1:183931224-183931246 CTTCCACAGCCTCACGGAACTGG + Intronic
920173218 1:204084312-204084334 CCCCCACAGCTGCCTGGGAGAGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924064242 1:240207546-240207568 CCCCCTCCTCTTCCCGGAGCGGG + Exonic
1062856682 10:783369-783391 CCCCTCCTGCTTCCCGGCACAGG - Intergenic
1065020970 10:21501210-21501232 CCCACACAGCTTCCAGCAACAGG + Intergenic
1065533534 10:26697396-26697418 CCTGCACAGCTTCCGGGAAGAGG + Intergenic
1066064493 10:31752261-31752283 CCCCCTCAGGTTCCAGGAAGTGG + Intergenic
1066239904 10:33523428-33523450 CACCCTCAGCCTTCCGGAACTGG + Intergenic
1067051166 10:43022154-43022176 CCCCACCAGCCTCGCGGAACAGG + Intergenic
1067744589 10:48926144-48926166 CCCCCACTGCCTCCCGGGAGAGG + Intronic
1069544679 10:69319541-69319563 CCCGCCCGGCTTCCCGGAACGGG + Intronic
1073553788 10:104428283-104428305 CCCCAACAACTTCCCAGAACAGG - Intronic
1074895409 10:117773153-117773175 CCCCCACAGCTTCCAAGTGCTGG + Intergenic
1075810465 10:125221278-125221300 CTCACACAGCTTCCCTGAAGTGG + Intergenic
1076138054 10:128058469-128058491 CCCACGCAGCTGCCCGGGACTGG + Intronic
1076725399 10:132410669-132410691 CCCTCACAGCTCCCAGGACCAGG - Intronic
1077366227 11:2162411-2162433 CCCTCCCAGCTCCCCAGAACAGG + Intergenic
1077542437 11:3153520-3153542 CCCCCGCAGCTTGCCAGAGCAGG - Intronic
1083437899 11:62655384-62655406 CTCCCACAGCTTCCCAGCATAGG + Intronic
1083847707 11:65345589-65345611 CCCCCACAGCTTGCAGGGATGGG + Intronic
1084041100 11:66543208-66543230 CCTCCCCAGCTTCCCATAACTGG + Intronic
1084543388 11:69801169-69801191 GCCACACAGCTTCCAAGAACTGG - Intergenic
1084974783 11:72790799-72790821 CCCTGCCAGCTTCCCAGAACTGG + Intronic
1085040562 11:73324109-73324131 CCCCCTCAGCTTCCCAGCCCAGG + Intronic
1087307109 11:96500741-96500763 CCCCCACAACCTCCCACAACGGG - Intronic
1089583469 11:119495764-119495786 CTCCCACAGCTTCCCCGGCCTGG + Intergenic
1089653884 11:119933103-119933125 CCCAGCCAGCTTCCCGGAGCTGG + Intergenic
1090522761 11:127496601-127496623 CCCCCACCTCTTCCAGAAACTGG - Intergenic
1090860282 11:130647064-130647086 CCACGGCAGCTTCCAGGAACTGG + Intergenic
1092239898 12:6829972-6829994 GCCCCAGAGCTTCCGGGACCTGG + Exonic
1096140064 12:49235370-49235392 CCCCGACACCTTTCCGGAAAGGG - Intronic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1096995377 12:55834907-55834929 CCCCCACACCGTCCTGGACCTGG + Intergenic
1097029074 12:56079164-56079186 CCCCACCAGCTGCCCGGACCTGG - Intergenic
1097191178 12:57220330-57220352 CCCCCACCGCGCCCCGGAGCCGG + Intronic
1098924146 12:76330526-76330548 CCCCCACAGCTTCTGGCAAAGGG + Intergenic
1101491603 12:105214830-105214852 CGCCCCCATCTTCCAGGAACGGG + Intronic
1104030994 12:125065674-125065696 CGCCCACAGCCGCCCGGAAGCGG - Exonic
1104733113 12:131119886-131119908 TCCCCAAAGCCTCCCGGACCAGG - Intronic
1111667536 13:91288120-91288142 CCACCTCAGCTTCCCGAATCAGG + Intergenic
1113565725 13:111318560-111318582 CTCCCGCAGCTTCCCGGTGCTGG + Intronic
1113976131 13:114228859-114228881 CCCGCAGAGCTTCCCCGCACTGG + Intergenic
1114556989 14:23567769-23567791 CCCCCAGCGCTTCCTGGTACGGG + Exonic
1120914794 14:89701674-89701696 CCCCCCCCGCTTCCCGGCGCCGG + Intergenic
1122415871 14:101549220-101549242 CCCCCACAGCGTCCCCGAGGAGG + Intergenic
1122502697 14:102211922-102211944 CCCCCACGGCTTCCCTGTCCAGG - Intronic
1122588393 14:102826986-102827008 CCCTCACAGCAGCCCGGAGCAGG - Intronic
1123028156 14:105438343-105438365 CCCCCACAGCTTCCCCAAGAAGG + Intronic
1123880915 15:24676817-24676839 CTCCCAGAGCTGCCCGCAACAGG + Exonic
1124221891 15:27856452-27856474 CCCCCACAGCTTCCTGCCACAGG - Intronic
1128311037 15:66631938-66631960 TCCTCACAACTTCCCCGAACAGG - Intronic
1132612033 16:821991-822013 CCCACACGGCTGCCCGGAAGTGG + Intergenic
1134069781 16:11253930-11253952 CCACAACAGCTTCCAGGAAGGGG - Intronic
1137319626 16:47367366-47367388 TCCCCACAGCCTCCAGGAATGGG - Intronic
1137322806 16:47402526-47402548 TCCCCACAGCATCCCGGCTCTGG + Intronic
1137764152 16:50964673-50964695 GAGCCACAGCTTCCAGGAACAGG - Intergenic
1138407798 16:56812265-56812287 CCCCCACACCTTCCAATAACAGG + Intronic
1139341858 16:66272646-66272668 CCCTGACACCTTCCTGGAACAGG + Intergenic
1141526367 16:84614474-84614496 CCCCCACGGCTTTCCAGAATGGG - Intronic
1141664105 16:85457070-85457092 CCCCCACAGCCACCCCGAGCAGG - Intergenic
1142190205 16:88713927-88713949 CCCCCACACCCTCACGGCACAGG - Intronic
1144044989 17:11447438-11447460 CCCCCACAGCTTCCCGGAACTGG + Intronic
1148164749 17:45475542-45475564 CCTCCTCAGCATCCCGGAGCAGG + Exonic
1149436595 17:56638781-56638803 CTCCCACAGCTTCTCGGACTTGG - Intergenic
1150395968 17:64822209-64822231 CCTCCTCAGCATCCCGGAGCAGG + Intergenic
1160250899 18:77202774-77202796 CCCCCACAGCCTCCCATGACAGG + Intergenic
1160859857 19:1233189-1233211 CCCGCACAGGTTCCCGGAGCTGG + Intronic
1161350562 19:3789073-3789095 CACCCACAGCTTCGTGGATCTGG + Intronic
1161977943 19:7616445-7616467 CCCCCACAGCCTGCTGGACCGGG + Intronic
1162428559 19:10612643-10612665 CCCCCACAGCTTCCGGACACTGG - Intronic
1162808813 19:13152296-13152318 CCCCCGCAGTTTCCCGCGACAGG - Exonic
1163063955 19:14779514-14779536 CCCCCACAGGAGCCCGGGACAGG - Intergenic
1165172846 19:33906087-33906109 CCCGCCCGGCCTCCCGGAACCGG - Intergenic
1165384660 19:35503214-35503236 GCCCCACAGCTTCGGGAAACGGG - Intronic
1166871341 19:45872791-45872813 CCCCCACATCTTCCCCGCCCTGG - Exonic
1168332698 19:55579303-55579325 CCCCCGCACCTTCCCAGAACCGG - Exonic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
928445819 2:31332623-31332645 CCACCTCAGCATCCCAGAACTGG - Intergenic
945251483 2:207769197-207769219 AACCCTCAGCTTCCCGGAAAAGG + Intronic
946201738 2:218074481-218074503 CCCCACCAGCTTCCAGGCACTGG + Intronic
1170304025 20:14917820-14917842 CCCCCACTGCTTCCCTGGAATGG - Intronic
1171180473 20:23087369-23087391 CCCCCAGAGTTTCCTGGCACTGG - Intergenic
1172490822 20:35336308-35336330 CACGCACAGGTTCCAGGAACTGG - Intronic
1172698259 20:36836870-36836892 CGCCAGCAGCTTCCTGGAACAGG + Intronic
1173136417 20:40443119-40443141 CCACCACAGCCTCCAGGAATGGG + Intergenic
1173615461 20:44400541-44400563 CCCCCACCCCCTCCCGGAGCAGG - Intronic
1174353376 20:49983297-49983319 CCCAGACAGATCCCCGGAACTGG - Intronic
1176077865 20:63256762-63256784 CCCCCACCCTTGCCCGGAACTGG + Intronic
1179241720 21:39598662-39598684 GCCCCACAGCTTCCCGCAGATGG - Intronic
1179529607 21:42009826-42009848 CCCCAACCCCTGCCCGGAACAGG + Intronic
1181003245 22:19997855-19997877 CCTCCACGGCTTACCGGGACGGG + Intronic
1181857537 22:25792819-25792841 ACCCCTCTGCCTCCCGGAACGGG - Intronic
1182277047 22:29196193-29196215 CCCTCACAGCTTCCCGGGGCTGG + Intergenic
1183437134 22:37802728-37802750 CCCCTCCAACTCCCCGGAACAGG + Intergenic
1183914047 22:41102449-41102471 CACTCACAGGTTCCCAGAACAGG - Intronic
950450713 3:13063585-13063607 CCCCCAATGCCTCCCAGAACCGG - Intronic
953768666 3:45762625-45762647 CCCCCACAGCTTACTGGGGCAGG - Intronic
954370802 3:50168733-50168755 CCCCCACAGGATCCAGGAAGGGG - Intronic
955536167 3:59925805-59925827 CCCACTCAGCTTCTCAGAACAGG + Intronic
956671715 3:71697561-71697583 CCCCCACAACTTCCCAGCTCTGG + Intronic
956712220 3:72048680-72048702 CCACCACAGCTTCCCAGAGGGGG + Intergenic
957182855 3:76903550-76903572 CCCCCACACCATCCCAGTACTGG + Intronic
961497520 3:127305127-127305149 CCCCCACAGCAGCCAGGAACAGG - Intergenic
962090879 3:132242961-132242983 TCAGCCCAGCTTCCCGGAACTGG + Intronic
962318019 3:134370872-134370894 CTCCCACAGCTTCCCACAGCTGG - Exonic
968282959 3:197490770-197490792 GCCCCACAGATTCCCAGAAGTGG + Intergenic
969455165 4:7296242-7296264 CCCTCACAGCCTCCGGGAGCTGG + Intronic
970200629 4:13600970-13600992 CCCTCACAACCTCCTGGAACTGG + Exonic
972736579 4:41847816-41847838 CCCCCACATTCTCCAGGAACTGG - Intergenic
973181568 4:47275088-47275110 CCCAGTCAGCTTCCTGGAACAGG + Intronic
976600557 4:86934748-86934770 CCCCCACAGCAGCCCGGGGCAGG + Intronic
983251378 4:165350305-165350327 CCACCACAGCTAGCCTGAACTGG + Intergenic
985728358 5:1527282-1527304 CCCCCACAGCTCCCTGGGGCTGG + Intergenic
985815478 5:2125116-2125138 AACCCACAGCCTCCCGGATCTGG - Intergenic
986130206 5:4923155-4923177 GCCCCACAGCTTCCTGGATGTGG - Intergenic
986307819 5:6528732-6528754 CACCCTCAGCTTCCCGGGCCAGG + Intergenic
995537657 5:113153357-113153379 CCCCCACAGACTCCATGAACTGG + Intronic
1001607641 5:172973945-172973967 CCACCTCAGCCTCCCAGAACTGG + Intergenic
1006034743 6:31202537-31202559 CCCCCACAGCTGCCCAGCCCTGG - Exonic
1006741448 6:36311911-36311933 TCACCACAGCATCCCAGAACAGG - Intergenic
1006781674 6:36636592-36636614 CTCCCACAGCTCCAAGGAACAGG + Intergenic
1006818937 6:36874925-36874947 CCACCCCAGCTTCCCGGCATTGG - Exonic
1007181814 6:39934254-39934276 CGTCCACAGCTTCCCGGGGCAGG - Intronic
1007424805 6:41739983-41740005 CCGCCCCAGCTGCCCTGAACTGG - Intronic
1009742053 6:67758607-67758629 CCCCCACAGCTCCAGGTAACAGG + Intergenic
1013369801 6:109458848-109458870 CAGCCACAGCTTCCCGGCCCAGG - Intergenic
1016157058 6:140823575-140823597 CTCCCTCATCTTCCCAGAACAGG + Intergenic
1019562918 7:1666958-1666980 CCGCGCCAGCTTCCCGGACCGGG - Intergenic
1024557425 7:50615507-50615529 CCCCAACACCTTCCCAGAGCCGG + Intronic
1026829774 7:73603490-73603512 CCCCCACCCCCTCCCGGGACTGG + Intronic
1028417647 7:90596590-90596612 CCCCGACAACTTCCCCAAACTGG - Intronic
1029495625 7:100894529-100894551 CCCTCACCTCTTCCCGGAACTGG + Intronic
1029731142 7:102439046-102439068 CCGCCGCAGCTACCTGGAACTGG + Exonic
1032202592 7:129832678-129832700 CTCACACACCTTCCCGAAACTGG + Exonic
1032545386 7:132737617-132737639 TCCCCACAGCTTCCCTGCCCTGG + Intergenic
1034318678 7:150159357-150159379 CCCCCACAGCTTCCAGGTAGAGG + Intergenic
1034638454 7:152585541-152585563 CCCCCACCTCCTCCCGGAAGGGG + Intergenic
1034774078 7:153807855-153807877 CCCCCACAGCTTCCAGGTAGAGG - Intergenic
1035418613 7:158709201-158709223 CCCTCACAGCTGCCCTGCACTGG - Intergenic
1040336703 8:46419721-46419743 CCCCCAGAGCTGTCCCGAACGGG + Intergenic
1041193407 8:55375877-55375899 CCCCCACACCCTCCCCTAACAGG + Intronic
1041470534 8:58203525-58203547 CCTCCACAGCCTCAAGGAACAGG - Intronic
1046636883 8:116680183-116680205 CCCCCCCACCCTCCCGGAAGGGG - Intronic
1048800726 8:138191620-138191642 CCCCCAGTGCTTCCCAGATCCGG - Intronic
1049546249 8:143232739-143232761 CTGCCACAGCTTCCCCGCACTGG - Intergenic
1049979666 9:892523-892545 CCCCCACATGTCCCTGGAACAGG + Intronic
1051279829 9:15431189-15431211 CCTCCACAGCTCCCCTGAACAGG + Intronic
1052856252 9:33408361-33408383 GCCCCAGTGCTTCCCTGAACGGG + Intergenic
1053202686 9:36163493-36163515 CAGCCACAGCTGCCAGGAACAGG - Exonic
1053417510 9:37955999-37956021 CCCCCTCACCTTCGCGGGACCGG - Exonic
1057206960 9:93179188-93179210 GCCCCACAGCTTCCCTGACTTGG - Intergenic
1059320617 9:113465627-113465649 CCTCCTCAGCTTCCCAGATCTGG - Intronic
1059379890 9:113914879-113914901 CCCCCTCATCTTCCCAGCACTGG + Intronic
1060470292 9:123942802-123942824 CACCCAGAGCCTCCCGGAATAGG + Intergenic
1060793625 9:126501100-126501122 CCTCCTCAGCCTCCCGGAGCCGG + Intronic
1060974240 9:127755175-127755197 CCCCCACACCGTCCCGGCCCCGG - Intronic
1061032269 9:128092475-128092497 CCCCCACAGCTCCAAGCAACTGG - Intronic
1061545432 9:131301645-131301667 CTCCCACAGCTTCCCGGGCCAGG + Intronic
1061561605 9:131407775-131407797 CTACCACAGCTTCTCAGAACTGG - Intronic
1062004704 9:134233384-134233406 CCCTCCCCGCTTCCAGGAACCGG - Intergenic
1062405646 9:136394991-136395013 CCCCCACAGCCTCACAGTACGGG - Intronic
1062552900 9:137098245-137098267 CCCCCAGAGCTGCCTGGGACTGG - Intronic
1185671309 X:1812381-1812403 CCGCAACAGCTTCCTGTAACAGG - Intergenic
1189555798 X:42144114-42144136 CTCCCACAGCCCACCGGAACAGG - Intergenic
1194663773 X:96655479-96655501 CCACAACAGCTCCCGGGAACAGG + Intergenic