ID: 1144047437

View in Genome Browser
Species Human (GRCh38)
Location 17:11466495-11466517
Sequence CACACTTCAGGGACATCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144047434_1144047437 -2 Left 1144047434 17:11466474-11466496 CCATGGAAGGTAACTTATTCACA 0: 1
1: 9
2: 104
3: 450
4: 948
Right 1144047437 17:11466495-11466517 CACACTTCAGGGACATCCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 133
1144047433_1144047437 5 Left 1144047433 17:11466467-11466489 CCTTTTGCCATGGAAGGTAACTT 0: 1
1: 11
2: 136
3: 465
4: 1062
Right 1144047437 17:11466495-11466517 CACACTTCAGGGACATCCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 133
1144047432_1144047437 6 Left 1144047432 17:11466466-11466488 CCCTTTTGCCATGGAAGGTAACT 0: 1
1: 9
2: 122
3: 401
4: 978
Right 1144047437 17:11466495-11466517 CACACTTCAGGGACATCCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 133
1144047429_1144047437 26 Left 1144047429 17:11466446-11466468 CCTAATCACATCTGCAAAGTCCC 0: 5
1: 36
2: 86
3: 210
4: 733
Right 1144047437 17:11466495-11466517 CACACTTCAGGGACATCCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144047437 Original CRISPR CACACTTCAGGGACATCCTC AGG Intronic