ID: 1144049505

View in Genome Browser
Species Human (GRCh38)
Location 17:11486477-11486499
Sequence ATATGCAAAGTACTATGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144049505 Original CRISPR ATATGCAAAGTACTATGCTA AGG Intronic
901193928 1:7429277-7429299 ATATGCCGTGCACTATGCTAAGG - Intronic
902500674 1:16909074-16909096 ACATGAAAACCACTATGCTAGGG + Intronic
902930028 1:19724547-19724569 ATATGCCAAGTGATATGCTAAGG - Intronic
906280367 1:44549288-44549310 ATATGCAAGGCATTGTGCTAGGG - Intronic
906816321 1:48883579-48883601 ATAGCAAAAGTACTATGTTAGGG - Intronic
907790643 1:57660222-57660244 ATATTCTAAGAACTATGCTAAGG + Intronic
908432788 1:64074930-64074952 ATGTGCCAGGTACTATCCTAAGG - Intronic
908981049 1:69959706-69959728 ATATGCAAAGTGCTACAGTAGGG + Intronic
909226408 1:73029947-73029969 ATATTCAAATTACGATTCTAGGG + Intergenic
910145343 1:84073760-84073782 ATATGCAAAGTATTATGAAAGGG - Intergenic
911548945 1:99255983-99256005 ATGTACAAAATACTATGTTAAGG + Intergenic
912171874 1:107110417-107110439 ATATTCAAAGAAATATGGTAAGG + Intergenic
913157516 1:116114587-116114609 TTGTGCAAAATACTGTGCTACGG + Intronic
913419267 1:118647059-118647081 ATATGCTAACTAATATACTAAGG - Intergenic
913699839 1:121363635-121363657 ATATACAAAGTAATGTGATATGG + Intronic
914137702 1:144916401-144916423 ATATACAAAGTAATGTGATATGG - Intronic
914200333 1:145479002-145479024 ACATGAAAACCACTATGCTAGGG - Intergenic
914381879 1:147123640-147123662 ATAGGCAAAGTTCCATGCTGAGG - Intergenic
914427508 1:147591549-147591571 ATGTGCCAAGCACTATTCTAAGG - Intronic
914479448 1:148052145-148052167 ACATGAAAACCACTATGCTAGGG - Intergenic
914506247 1:148291750-148291772 ATGTGCCAGGTACTGTGCTAAGG - Intergenic
914516907 1:148382076-148382098 ACATGAAAACCACTATGCTAGGG - Intergenic
916337518 1:163690192-163690214 CTATGGAATGTACAATGCTATGG + Intergenic
917071155 1:171152326-171152348 ATATGCAAAGCACTGTGCTAGGG + Intronic
917423601 1:174890396-174890418 ATGTGCCAGGTACTATGGTAGGG - Intronic
917743028 1:177979978-177980000 ATATGCTTAGTAATATGCTTTGG - Intronic
918370969 1:183861150-183861172 ATATGCCAGGTACTGTGCTAAGG - Intronic
918584907 1:186175444-186175466 ACATACAAAATATTATGCTAGGG - Intronic
920118687 1:203639334-203639356 ATATGCCAAGCACTATGTTAAGG + Intronic
920487252 1:206382344-206382366 ATATACAAAGTAATGTGATATGG + Intronic
921803738 1:219431216-219431238 ATATCCAAAGAACTATCATATGG + Intergenic
921839796 1:219816094-219816116 ATATGCCTGGTGCTATGCTAGGG - Intronic
924014104 1:239701171-239701193 ATGTGCAGAGTTCTATGCTTAGG - Intronic
1062783824 10:243240-243262 ATGTGCTAGGTACTATGCTCAGG - Intronic
1063755007 10:8997674-8997696 ATATGCTCAGCACTCTGCTAGGG + Intergenic
1064358393 10:14640636-14640658 TTATGCAAGGTGCTATCCTAGGG - Intronic
1064836799 10:19541425-19541447 ACATGAAAAGTAATATTCTAGGG + Intronic
1065682583 10:28252160-28252182 ATTAGCAAAGTACTATGTCAGGG + Intronic
1065841751 10:29707761-29707783 ATATGCCAGGCACTGTGCTAAGG + Intronic
1067158531 10:43802909-43802931 ATATGCAAAGCAGCAGGCTAGGG - Intergenic
1067423133 10:46176226-46176248 AAACCCAAAGTACTATACTATGG + Intergenic
1068440065 10:57041751-57041773 AAATGCAAAGTAGTGTGCAAGGG + Intergenic
1069415274 10:68194876-68194898 ATAGGCAAATTACTTTGCGAAGG + Intronic
1070878255 10:79836313-79836335 AAACCCAAAGTACTATACTATGG - Intergenic
1071235216 10:83637986-83638008 AGATACAAGGTACTTTGCTAAGG - Intergenic
1072114010 10:92350797-92350819 ATATACAAAGAAGAATGCTAGGG - Intronic
1074099247 10:110341091-110341113 ATATGGCAAGAAATATGCTAGGG + Intergenic
1074281236 10:112053540-112053562 AGGTGCCAAGAACTATGCTAGGG - Intergenic
1074837231 10:117308493-117308515 ATGTGCCAGGTATTATGCTAAGG + Intronic
1075045627 10:119143960-119143982 TTATGCCTATTACTATGCTATGG - Intronic
1075468413 10:122669858-122669880 ATATGCAAAACATTATGCTTGGG - Intergenic
1077901112 11:6489542-6489564 ATATGCCAAGCACTGTGATAAGG - Intronic
1078740993 11:14066123-14066145 AAATGCTAAGTAATGTGCTAAGG + Intronic
1078832332 11:14989963-14989985 ATATGAAAAGTAATATCCTAGGG + Intronic
1079976811 11:27102172-27102194 AAAAGCAAAGTACAGTGCTAAGG + Intronic
1080926843 11:36766460-36766482 ATTTGCATAGTAATATGCTGAGG - Intergenic
1081792354 11:45797208-45797230 GTGTGCAAGGTACTGTGCTAGGG + Intergenic
1083091535 11:60204339-60204361 AGATGCAAAGGATTTTGCTAGGG + Intronic
1083778698 11:64907047-64907069 GTATGTAAAGCACCATGCTAGGG - Intronic
1085029777 11:73264137-73264159 ATGTGCCAAGCACTGTGCTAAGG - Intergenic
1085210468 11:74772410-74772432 AAGTGCCAAGTACTGTGCTAGGG - Intronic
1086270001 11:85051486-85051508 ACGTGCCAAGCACTATGCTAAGG + Intronic
1087488959 11:98798300-98798322 ATATGCACAGTACTATCCTTAGG - Intergenic
1089249900 11:117151049-117151071 AAATGCAAAGGACTATGAAAAGG - Intronic
1089254162 11:117185404-117185426 ATATGCCAGGTGGTATGCTAAGG + Intronic
1089701689 11:120248435-120248457 ATGTGCCAAGCACTGTGCTAAGG - Intronic
1089918688 11:122185712-122185734 CTATGCTAAGCACTATTCTAGGG - Intergenic
1092648311 12:10604103-10604125 ATATGGAAAAGACTGTGCTAGGG + Intergenic
1093546872 12:20359104-20359126 GTATGCAAAATACCATGCCAGGG + Intergenic
1093858254 12:24132152-24132174 ATGTGCCAAGTAGTCTGCTATGG + Intergenic
1093874916 12:24339012-24339034 ATATGCCAGGTAGTATTCTAGGG + Intergenic
1094220376 12:27986553-27986575 ATATTCAAAGTACTTTACTCAGG - Intergenic
1094609702 12:31981823-31981845 ATATGCTGAGTACTTTGCAAAGG - Exonic
1095571874 12:43692778-43692800 GTATGCAAAGTACTTTGGCATGG + Intergenic
1096234078 12:49913958-49913980 ATATGCTAGGTCCCATGCTAAGG + Intergenic
1098646407 12:72907394-72907416 ATTTGCCAAGTCCTATTCTAAGG + Intergenic
1099411017 12:82328039-82328061 ATAAGCAAAGACTTATGCTAAGG + Intronic
1099604590 12:84786521-84786543 ACATGCTAAGTAATATTCTAGGG - Intergenic
1100116818 12:91315733-91315755 ATGGGCAAAGAACTTTGCTATGG - Intergenic
1101494660 12:105242290-105242312 ATGTGCCAGGTACTATACTAAGG + Intronic
1101554500 12:105795665-105795687 ATATGCCAGGCACCATGCTAAGG - Intergenic
1101653006 12:106694705-106694727 ATATGCCAGGTACTTTGCTTAGG - Intronic
1101657073 12:106731932-106731954 TTATGCCAAGCACTAGGCTAAGG + Intronic
1101791830 12:107934666-107934688 ATTAACAAAGTACTATGCTAAGG - Intergenic
1102922003 12:116798481-116798503 AGATGCAAACTACCTTGCTAAGG - Intronic
1104873783 12:132018877-132018899 ATATCCAAAATCCTATGCTTGGG + Intronic
1105059806 12:133138790-133138812 ATATGCCAAGTACTATCCTAGGG - Intronic
1105843765 13:24277715-24277737 GTATGCCAGGTACTATGCTAGGG + Intronic
1105904709 13:24795482-24795504 ATCTCCAAAGTACAATGTTAAGG - Intronic
1106064937 13:26336919-26336941 ATATGATAAGTGCTATGATATGG - Intronic
1106986397 13:35357056-35357078 ATATGCAGAGTTCTATGCACTGG - Intronic
1110010309 13:70324959-70324981 ATATGCAAAGCTGTATTCTAAGG + Intergenic
1110155520 13:72312171-72312193 ATATGCCAGGCACTATGCTATGG + Intergenic
1110200973 13:72850408-72850430 CTATGTTAAGTACTATGTTAAGG - Intronic
1112107598 13:96258797-96258819 ATATGTCAGTTACTATGCTAAGG + Intronic
1112627089 13:101117391-101117413 ACATGCAAATTACAATGCAAAGG + Intronic
1115114976 14:29869680-29869702 GTGTGCCAAGCACTATGCTATGG + Intronic
1115117487 14:29899771-29899793 ATGTGCAAAGCACTATGATATGG + Intronic
1115410444 14:33068083-33068105 CTATGCAAAGCACCATGCTAGGG + Intronic
1115803528 14:37023934-37023956 ATATGTTAAATACTATGCTGCGG - Intronic
1115882956 14:37940886-37940908 CTATGCCAAGTCCTATGCCAAGG - Intronic
1116707769 14:48325047-48325069 ATGTTTCAAGTACTATGCTAGGG + Intergenic
1117127020 14:52640089-52640111 ATATGCCAAAAACTATGCTATGG + Exonic
1118989841 14:70787883-70787905 ACATGCGAAGTCCTATACTAGGG + Intronic
1119068374 14:71553876-71553898 TTATACAAAACACTATGCTAAGG - Intronic
1119474823 14:74921079-74921101 ACATGCCAGGTACTATTCTAAGG - Intronic
1119838816 14:77774994-77775016 ATGTGCTAAATACTATCCTAGGG - Intergenic
1120006693 14:79365971-79365993 ATGTGACTAGTACTATGCTAGGG + Intronic
1120196644 14:81491489-81491511 AAATACCAAGTTCTATGCTATGG + Intronic
1120565692 14:86053309-86053331 ATATGCCAGCTGCTATGCTATGG + Intergenic
1124854883 15:33378119-33378141 CTATGCCAAGCATTATGCTAAGG - Intronic
1125802580 15:42463385-42463407 ATATTCAAGGTATTATGATAAGG + Intronic
1126380142 15:48038135-48038157 ATATGCCAAGCACTGTTCTAAGG + Intergenic
1127759493 15:62124192-62124214 CTATGCAAAGTACTTTGCATGGG + Intergenic
1128195648 15:65752671-65752693 ATATGAAAAGTAATATTCTCAGG + Intronic
1128257874 15:66211803-66211825 ATATTCAAAATGCTACGCTAAGG + Intronic
1128645556 15:69376381-69376403 CTATGCAAAACACTTTGCTAAGG + Intronic
1128990500 15:72255750-72255772 ATATGTAAAGTACTGTTTTAGGG - Intronic
1129077445 15:73009149-73009171 ATAAGCTAAGTACTATACTAAGG + Intergenic
1129113502 15:73352064-73352086 ACATGATAAGTACTATGCCAGGG - Intronic
1130363451 15:83210930-83210952 TTATGCAAAGGACTAAGCTGTGG + Intergenic
1130569080 15:85024299-85024321 ATATGCCAGGTACTGTGCCAGGG - Intronic
1130969708 15:88722275-88722297 ACATGCCAAGCACTGTGCTAAGG - Intergenic
1131018207 15:89075262-89075284 AGATGCAAAGACCTATGATAAGG - Intergenic
1131396943 15:92093696-92093718 ATGTGCCAAGTACTATTCTCAGG - Intronic
1131960028 15:97780454-97780476 CAAAGCAAAGAACTATGCTATGG + Intergenic
1131984730 15:98031112-98031134 ATATGCAAATATCAATGCTATGG - Intergenic
1133071623 16:3250214-3250236 ATTTGCCAGGTACTCTGCTAGGG - Intronic
1133515263 16:6502533-6502555 ATGTGTTAGGTACTATGCTAAGG - Intronic
1134555675 16:15161945-15161967 ATATGCCAGGTCCTGTGCTATGG + Intergenic
1134916257 16:18073656-18073678 ATATGCCAGGTTCTGTGCTATGG + Intergenic
1136372756 16:29846391-29846413 AAATGCAAAGTACTTGGATAGGG - Intronic
1137316505 16:47329859-47329881 ATGTGCCAAGAACTATGCAAAGG - Intronic
1137340227 16:47594637-47594659 ATGTTCAAAATACAATGCTAAGG - Intronic
1137433244 16:48435188-48435210 AGATGCAAAGTAACATGCCAAGG - Intronic
1138162582 16:54768752-54768774 ATGTACCAGGTACTATGCTACGG - Intergenic
1138780721 16:59781873-59781895 ATATGAAAGCTACTATGCAATGG - Intergenic
1138866873 16:60832532-60832554 ATATGTTAAGTACTATAATAAGG - Intergenic
1139112885 16:63913462-63913484 ATCTGCAAAATCCTTTGCTATGG - Intergenic
1140734386 16:77884943-77884965 ATATCCAAAGTACTATTCTGTGG - Intronic
1140780353 16:78290576-78290598 AAATTCAAAGTACTACACTAAGG - Intronic
1141513530 16:84527766-84527788 ATGTGCCAAGCACTATTCTAAGG + Intronic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1144049505 17:11486477-11486499 ATATGCAAAGTACTATGCTAAGG + Intronic
1149608985 17:57945668-57945690 ATATGCAAAACATTGTGCTAGGG + Intronic
1149689230 17:58560157-58560179 ATGTCCAAAGCACTGTGCTAGGG - Intronic
1149732599 17:58961315-58961337 ATCTGCTAGGTACTATACTATGG + Intronic
1150147293 17:62779631-62779653 GTATGCAAAGCATTGTGCTATGG + Intronic
1153328011 18:3841692-3841714 TCCTGCAAAGTACTGTGCTAAGG - Intronic
1156388915 18:36632270-36632292 AAATGCAAATTACAATGCTGAGG - Intronic
1157017628 18:43736555-43736577 ATATGTAAAGTGCTCTGCTGAGG + Intergenic
1157828189 18:50831443-50831465 ATGTGCCAAGTACTGTGCTGGGG - Intergenic
1158260188 18:55597949-55597971 CTATGAAAAGCACTATGCAAGGG + Intronic
1159535934 18:69714937-69714959 ATATACAAAGTAATTTTCTACGG - Intronic
1160048990 18:75414340-75414362 ACATGCCAAGTACTGTGCTAGGG + Intronic
1161758776 19:6155025-6155047 ATTTGCTAAGCACTGTGCTAAGG - Intronic
1166583464 19:43924388-43924410 AAATGCCAGGTACTATGCCAAGG - Exonic
1166667620 19:44690434-44690456 ATACGCCATGCACTATGCTAAGG + Intergenic
1167851597 19:52206457-52206479 AAGTGCCAAGTACTGTGCTAGGG - Intronic
925597529 2:5570666-5570688 AAAAGAAAAGGACTATGCTAGGG - Intergenic
926079079 2:9969263-9969285 ATATGCTAGGTGCTGTGCTAAGG + Intronic
927425008 2:22971484-22971506 ATATCCAAGGTACTATGATGAGG + Intergenic
927710718 2:25324216-25324238 ATGTGCCAAGCACTGTGCTAAGG + Intronic
928082050 2:28320316-28320338 ATGTGCAGAGCACCATGCTAAGG + Intronic
928275152 2:29893966-29893988 ATGTGCCAAGCACTCTGCTAAGG - Intronic
929093411 2:38241660-38241682 ACATGCCAGGCACTATGCTAAGG + Intergenic
930341415 2:50120520-50120542 ATAGGCAATGTGCTATGCAATGG + Intronic
931274028 2:60728189-60728211 ATCTGCAAAGTACTTTCCTCAGG + Intergenic
931604072 2:64034240-64034262 ATGTGCAAATCACTATACTAAGG - Intergenic
932132221 2:69197995-69198017 ATATGCAATGTAATATGACATGG - Intronic
933082667 2:78012570-78012592 ATAAGTAAAGTACTTTGTTAAGG - Intergenic
933394624 2:81715166-81715188 CTCTGCAAAGTTCTATGATAAGG + Intergenic
937005833 2:118513089-118513111 ACATGCCAGGTACTATTCTAAGG + Intergenic
937640682 2:124207432-124207454 ATTTGCAAAGTACAATGTTGGGG + Intronic
937680557 2:124640078-124640100 GTATGCAGAGCACTATGTTAGGG - Intronic
938226477 2:129620740-129620762 ACATGCAAAATACTGTTCTATGG - Intergenic
939418026 2:141925878-141925900 AGATGTTAAGTACTTTGCTAAGG - Intronic
939507873 2:143071624-143071646 TTATTCAAAGTCCTATGCTGTGG - Intergenic
939953663 2:148505974-148505996 ATGTGCCAAGTACTGTGCTGAGG - Intronic
941036611 2:160575727-160575749 ATGTGCTAAGGACTATGCTAAGG + Intergenic
941215855 2:162708156-162708178 ATATGCTAAGAACTATTCCATGG - Intronic
941441543 2:165543861-165543883 ATATGCAAAGCACTTTTCTAGGG + Intronic
942513976 2:176732425-176732447 ATAAGGAAAGTACTATGCAGTGG + Intergenic
942597439 2:177605068-177605090 ATACACATAGTACTAGGCTATGG - Intergenic
944662977 2:201936600-201936622 ATATGTTAGGTCCTATGCTATGG + Intergenic
946064093 2:216971406-216971428 ATATACAAAGAACTATTTTAGGG - Intergenic
946657446 2:221963419-221963441 AAATGCAGAGAAATATGCTAAGG + Intergenic
947373454 2:229471723-229471745 ATTTGCAAAGCACAGTGCTAAGG + Intronic
1170296669 20:14833846-14833868 TTATGCAATTTACTAAGCTATGG - Intronic
1170882291 20:20307423-20307445 GTATGTAAAGTACTATACAAGGG + Intronic
1173347617 20:42215409-42215431 ATATGCCAAAGACCATGCTAGGG - Intronic
1173846153 20:46189995-46190017 GTTTGCAAACCACTATGCTAGGG + Intronic
1174847496 20:53957282-53957304 ATATGCCAAGAACTATGTTGGGG - Intronic
1174886800 20:54344647-54344669 ATATGCCAAGTACTATGCAAAGG - Intergenic
1175031932 20:55963325-55963347 ATGTGCAAGGCACTGTGCTATGG + Intergenic
1177906282 21:26974675-26974697 ATATGCAAAGGACTGAGCTAGGG - Intergenic
1178769123 21:35485905-35485927 AAGTGCAAGGTACTGTGCTAGGG - Intronic
1180234347 21:46448393-46448415 TGATGCAAAGTACTATTCTTGGG + Intergenic
1182181347 22:28352231-28352253 ATGTGCAAAGTAATATCCTAGGG + Intronic
1184351234 22:43945512-43945534 ATGTGCCAAGTACCATGCTACGG - Intronic
951320090 3:21233979-21234001 ATGTGCCAAGTATTATGCCAGGG - Intergenic
951883487 3:27501934-27501956 ATATGCCAAGCAGTACGCTAAGG + Intergenic
952684215 3:36130904-36130926 GTCTGCAAAGGACTATCCTAAGG + Intergenic
953700560 3:45192290-45192312 ATGTGCCAGGTACTATTCTAAGG - Intergenic
955145707 3:56316986-56317008 GTGTGCTAAGCACTATGCTAAGG + Intronic
955389084 3:58506397-58506419 AAAAGAAAAGTGCTATGCTAAGG - Intronic
955690847 3:61589369-61589391 ATATGCAAAGTGCTAAGTTCAGG - Intronic
956747982 3:72324463-72324485 ATGTGCCAGGCACTATGCTAGGG + Intergenic
957316223 3:78579914-78579936 ATATGCAAACTAATATTTTAAGG + Intergenic
957836008 3:85590259-85590281 ATATGACAAAGACTATGCTAAGG + Intronic
958798395 3:98730880-98730902 ATCTGCAAAGCAGTGTGCTAAGG - Intergenic
959160031 3:102712126-102712148 ATGTGCAAGGCACTATTCTAGGG - Intergenic
959635148 3:108558510-108558532 ATGTGCCAAGTGCTATGCTAGGG + Intronic
959831775 3:110871586-110871608 ATCTTCAAAGAATTATGCTAAGG - Intergenic
960116662 3:113901518-113901540 ACATGCTAAGCACTATGTTAGGG - Intronic
960188153 3:114669697-114669719 ATATGGAAAATACTATGCACAGG - Intronic
960666506 3:120114191-120114213 ATATGTAAAGTACTATCTTGTGG - Intergenic
961235734 3:125365180-125365202 ATGTGCAAGGTTCTATGGTAGGG - Intronic
961620443 3:128219740-128219762 ACATGCCAAGCACTATGCTAAGG - Intronic
961825902 3:129598930-129598952 ATATGTAAAGTGCTCTGCAAAGG + Intronic
961918449 3:130401317-130401339 AAAAACAAAATACTATGCTATGG - Intronic
962885945 3:139627923-139627945 GTATGCCAAGTGCTATGCCAAGG + Intronic
963398681 3:144768663-144768685 ATTTGCAAAGTACCATGCACTGG + Intergenic
963486657 3:145942767-145942789 ATACGCCAACCACTATGCTAAGG + Intergenic
965848269 3:172990005-172990027 ATAAGCAAAGTGCTATGACAGGG - Intronic
965932017 3:174056005-174056027 ATATGCTAAGTATTGTGCTCTGG + Intronic
965952146 3:174322617-174322639 ATATGTCAAGTACTATGCTCAGG + Intergenic
967644535 3:191905814-191905836 ATGTGCAAAGTAATATTTTAGGG - Intergenic
969103375 4:4786665-4786687 AAATGCAAAGTACAAAGCCACGG - Intergenic
969987231 4:11225009-11225031 ATGTGCCAGGTACTATGCTAAGG - Intergenic
970845212 4:20529658-20529680 ATGTGCAAGGTCCTATGTTAAGG - Intronic
970852772 4:20621308-20621330 ATATGCCAGGTACTATGCTCAGG + Intergenic
970936436 4:21576382-21576404 AAATGCAAAATACTGTGCTCTGG - Intronic
970936667 4:21579206-21579228 AAATGCAAAATACTGTGCTCTGG - Intronic
971139744 4:23911248-23911270 ATGTGCCCAGTGCTATGCTAGGG - Intergenic
972231387 4:37076247-37076269 ATGTGCCAAATACTAGGCTAGGG - Intergenic
973869721 4:55153955-55153977 ATATGCCAGGTACTATTCTAAGG - Intergenic
974573189 4:63682634-63682656 ATACCCAAAGAACTATGATATGG - Intergenic
974775720 4:66477893-66477915 ATATGAAAAGAAATATGCTTTGG - Intergenic
976998958 4:91471294-91471316 CTATGGAAAATACTATGCTGTGG + Intronic
977428089 4:96894816-96894838 CTGTGCAAAATGCTATGCTATGG + Intergenic
978054003 4:104240209-104240231 ATATGCAAGGCACTGTGTTAAGG - Intergenic
979525369 4:121710403-121710425 ATTCGCAAAGTAATATGCAAAGG + Intergenic
979952712 4:126914377-126914399 ACATGCATATTACTATGCAAAGG + Intergenic
981573822 4:146182518-146182540 TTATGCAAAGCATTCTGCTAAGG - Intronic
981972804 4:150685754-150685776 CTGTGCAAAACACTATGCTAGGG + Intronic
983212497 4:164973141-164973163 ATATGTCAGGCACTATGCTAAGG + Intronic
983317268 4:166148485-166148507 TTATGTAAAGTTCTATGCCAAGG + Intergenic
984168717 4:176334997-176335019 ATTTGAAAAGTATTAGGCTAAGG + Intergenic
984541921 4:181049551-181049573 ATATGCAAAGCACTTGACTATGG + Intergenic
985132437 4:186752179-186752201 ATTTGCAAAATATTATCCTAGGG - Intergenic
985977953 5:3436491-3436513 ATTTGAAAAGTACTTTGCTTTGG - Intergenic
988206949 5:28150098-28150120 ATATGTACAGTACTGTACTATGG + Intergenic
990046007 5:51432573-51432595 AAATGGAAAGTACAATGATATGG - Intergenic
990595832 5:57311466-57311488 AGATGCAAAGCACTATGGCAGGG + Intergenic
991140901 5:63241383-63241405 ATATTCAAGGAACTATGCAAGGG - Intergenic
991284882 5:64961849-64961871 ATATGTCAAGCACTATGCTAGGG - Intronic
991337747 5:65568269-65568291 ATGTCCCAGGTACTATGCTAAGG + Intronic
991524674 5:67543124-67543146 ATATGTTAGGTACTATCCTAGGG - Intergenic
992103213 5:73427181-73427203 ACATGTAAAGTACTAGGCTTTGG - Intergenic
992706363 5:79398344-79398366 ATATGTAAAGAACTGTGATAGGG - Intronic
993059517 5:83022167-83022189 ATGTGCCAATTACTATGCTGGGG - Intergenic
993927805 5:93892859-93892881 GTATGCTAAGTAATCTGCTAAGG - Intronic
994556038 5:101304543-101304565 ATAAGCAAAGTATTCTGCTTAGG + Intergenic
994618940 5:102139915-102139937 GTATTCAAAGTAATATGCAATGG - Intergenic
996611482 5:125385941-125385963 ATGTGAAAAGAACAATGCTAAGG - Intergenic
997324236 5:133006605-133006627 GTGTGCCAAGTACTATTCTAGGG - Intronic
997662080 5:135597041-135597063 ATATGCTAGGCACTATGCTGGGG - Intergenic
997720643 5:136076040-136076062 GTATGCCAAGCACTATGCTAGGG + Intergenic
998045368 5:138982736-138982758 ATCTGAAAAGAACTATGCTAGGG - Intronic
998714276 5:144864690-144864712 CTATGCTAGGGACTATGCTAGGG - Intergenic
998916519 5:147018173-147018195 ATATATAAAGTACTATTATATGG + Intronic
999190366 5:149742628-149742650 ATGTGCCAGGTACTAAGCTAGGG + Intronic
999508044 5:152218762-152218784 CTGGGCAAAGTACTTTGCTATGG - Intergenic
1000006437 5:157189107-157189129 AATTGCAAAGTACTTTGCTTGGG - Intronic
1000076389 5:157791506-157791528 GAATGCAAATGACTATGCTAGGG + Intronic
1001047986 5:168390228-168390250 ATATGAAAAGTACAATTCCAAGG - Intronic
1001133074 5:169080344-169080366 ATGTGCCAAGCACTGTGCTAGGG + Intronic
1001371752 5:171211052-171211074 ATGTGCTATGTACTATGCTAAGG - Intronic
1002129739 5:177073180-177073202 ATAAGCACAGTCCTATGCTAGGG - Intronic
1004143163 6:13040046-13040068 AGATGCAAAGTACTGTGCAAAGG - Intronic
1005057593 6:21744607-21744629 AAATGCAAAGTACTTTGGGATGG - Intergenic
1005178206 6:23072177-23072199 GGATGCAAAGTACTATGCCAGGG - Intergenic
1008055847 6:46945461-46945483 ATGTGCCAGGTACTGTGCTAGGG + Intronic
1008496330 6:52137643-52137665 ATATTCAAAATACTTTGCCAAGG - Intergenic
1009353696 6:62712927-62712949 ATTTGCAAAGCACGATGCTGAGG + Intergenic
1010354399 6:74914326-74914348 ATGTGCAAAAACCTATGCTAAGG - Intergenic
1010674307 6:78723120-78723142 ATATGCAAAATAATAAGCTCTGG - Intergenic
1011180650 6:84616224-84616246 ATATACAAGGTATTATACTATGG - Intergenic
1011757746 6:90521675-90521697 GTTTGCAAAGTACTAAGCAAAGG + Intronic
1011809264 6:91111629-91111651 ATTTGCAAAGTACAGTGCTCTGG - Intergenic
1011973846 6:93266525-93266547 ATATTAAAAGTAATTTGCTAAGG + Intronic
1012537513 6:100316820-100316842 ATATGCAAAGTCCTCTGATGAGG + Intergenic
1013294676 6:108748032-108748054 ATATGCCCAGGACTATGCCAAGG + Intergenic
1013715615 6:112957370-112957392 TACTGCAAAGTACTATGCTGAGG + Intergenic
1014457891 6:121657969-121657991 ATATACCAGGCACTATGCTAGGG - Intergenic
1014653893 6:124074831-124074853 CTATGTAAAGTGCTATGATAAGG - Intronic
1015150586 6:130032576-130032598 ATCTGGTAAGTACTATGCTGTGG + Intronic
1015351060 6:132220370-132220392 ATATGTAAAGTGCTAGGATAAGG - Intergenic
1020712613 7:11627528-11627550 AAATGCAAAGTACTTTTTTAAGG + Intronic
1021463029 7:20910559-20910581 ACATGAAAATTGCTATGCTAAGG + Intergenic
1021481283 7:21120549-21120571 ATGTGCAAAGTACCAGGCTTAGG + Intergenic
1021546571 7:21820204-21820226 ATATGCCAGGTACTATACTGGGG + Intronic
1021582475 7:22171449-22171471 ATATGCATATTAATATGCTTAGG - Intronic
1026333970 7:69378069-69378091 ATGTGCCAAGCATTATGCTAGGG + Intergenic
1027667742 7:81059779-81059801 ATGTGCAATGCAATATGCTAGGG + Intergenic
1027931648 7:84543535-84543557 AAATGCACATTACTATGATACGG - Intergenic
1028128768 7:87146310-87146332 GTAACAAAAGTACTATGCTATGG + Intergenic
1028270793 7:88786324-88786346 ATATGCAGAGTCATATCCTAGGG - Intronic
1030223653 7:107125356-107125378 ACATGCCAGGTACTATTCTAAGG - Intronic
1032534453 7:132650323-132650345 ATGTGCCAAGCACTATTCTATGG - Intronic
1032589565 7:133178986-133179008 ATCTGCCAAGTAGTATACTATGG - Intergenic
1032993003 7:137414407-137414429 ATGTGCAAAGCATTATGCTAGGG - Intronic
1033408962 7:141098683-141098705 ATGTGCCAGGTACTATTCTATGG - Intronic
1034747802 7:153538604-153538626 CTATGCAAAGCACTATTCTGGGG + Intergenic
1035132350 7:156667708-156667730 TAATTCAAAGTACTATCCTATGG - Intronic
1035552072 8:536120-536142 TTATACAGAGTAATATGCTAAGG + Intronic
1036571926 8:9987266-9987288 ATATGCACATTACTATACTAGGG + Intergenic
1037407633 8:18560778-18560800 ATGGGCAAAGGACTTTGCTATGG + Intronic
1037924127 8:22831516-22831538 ATATACTAAGCACCATGCTAAGG + Intronic
1038599089 8:28920286-28920308 ATAAACAAGGTACTATGGTAGGG + Intronic
1039247140 8:35621349-35621371 ACATGCTAGGTACTCTGCTATGG - Intronic
1042116687 8:65439536-65439558 ATATGCCAGGCATTATGCTAAGG - Intergenic
1042181790 8:66096391-66096413 ATTTGAAAAGGACTATGTTATGG - Intronic
1042271382 8:66959656-66959678 ATGTGCAAAGCACTATTTTAGGG - Intronic
1042667662 8:71223822-71223844 ATATGCAAAATATTAAGTTATGG + Intronic
1043103035 8:76070922-76070944 AAATGCAAAATAGTATGATATGG - Intergenic
1043403889 8:79911219-79911241 TAATGCAAGGTACCATGCTAAGG + Intergenic
1045349138 8:101322424-101322446 AAATGCAAAGGCCTATGATATGG - Intergenic
1045426491 8:102071414-102071436 ATGTTTAAAGCACTATGCTAGGG + Intronic
1045761512 8:105613624-105613646 ATATACAAGGTAAGATGCTAAGG - Intronic
1045797524 8:106063353-106063375 AAGTGCAAGGTACTATTCTAGGG - Intergenic
1047124122 8:121941346-121941368 AGATGCAAAGTGGTATGCAAAGG + Intergenic
1047775031 8:128063061-128063083 AAAGGCCAAGTACTGTGCTAGGG - Intergenic
1048244390 8:132776965-132776987 ACATGCAAAGTACTATATTTTGG - Intronic
1048315456 8:133358595-133358617 ATATGCCAGGTACTCTTCTAAGG - Intergenic
1049022216 8:139965194-139965216 ACGTGCAAAGCACTGTGCTAGGG - Intronic
1051291337 9:15548741-15548763 ATGTGCCAAGCACTATACTAAGG - Intergenic
1052312536 9:27083396-27083418 ACATGCAAAGCATTATTCTAGGG - Intergenic
1052595651 9:30554638-30554660 ATATGCATCGTATTCTGCTAGGG - Intergenic
1055419296 9:76120973-76120995 ATATGGAAAGTACTAAAATAAGG + Intronic
1055677280 9:78677323-78677345 GTGTGCCAAGAACTATGCTAAGG + Intergenic
1058549995 9:106104459-106104481 ATATAATAATTACTATGCTAGGG + Intergenic
1058586395 9:106511022-106511044 ATATGCCAGGTACTATTCTAGGG - Intergenic
1059306976 9:113361407-113361429 ATATGTGAAGCACTGTGCTATGG + Intronic
1060139711 9:121199982-121200004 ATATGCCAAGCAATGTGCTAAGG + Intronic
1060563926 9:124572030-124572052 ATATGGACAGTACAATGCCAGGG + Intronic
1060716929 9:125940433-125940455 ATGTGCCAAATACTGTGCTAGGG + Intronic
1060730844 9:126036059-126036081 ATGTGCCAAGCACTGTGCTAAGG + Intergenic
1188339494 X:28981482-28981504 ATATGCAAAGAAATATATTAAGG + Intronic
1188741102 X:33783132-33783154 ATATGCAGAGTACCATGCTAGGG - Intergenic
1188964945 X:36539469-36539491 ATATCCAAGGTAATATGCTTAGG + Intergenic
1189818264 X:44845636-44845658 ATGTGCCAGGTACTATGCTAAGG - Intergenic
1190225889 X:48544734-48544756 ATGTGCAAGGTACTGTGCCAAGG - Intronic
1192096185 X:68213496-68213518 ATATACCAGATACTATGCTAGGG - Intronic
1193220271 X:78916441-78916463 ATATGCAAGATAATATACTAGGG + Intergenic
1193430498 X:81397345-81397367 TAATACAAAGTACTATGATAGGG + Intergenic
1193678462 X:84485894-84485916 ATATGGAAAGTGATATACTATGG - Intronic
1193725140 X:85029397-85029419 ATGTGCACAACACTATGCTAGGG + Intronic
1193847151 X:86486848-86486870 ATATGTCTAGCACTATGCTAAGG - Intronic
1193920915 X:87425205-87425227 ATGAGCAAAAGACTATGCTAGGG + Intergenic
1194835697 X:98679973-98679995 ATTGGCAAAGAACTATGCTTTGG - Intergenic
1195658723 X:107357839-107357861 ATGTGCCAAGTACTGTGATAGGG - Intergenic
1195724559 X:107900912-107900934 CTGTGCAAAGCATTATGCTAAGG - Intronic
1196008325 X:110858666-110858688 ATGTGCCAAGAACTATACTAAGG + Intergenic
1196038843 X:111178545-111178567 ATGTGCCATGTACTGTGCTAAGG - Intronic
1198196796 X:134371550-134371572 ATGTACAAAGCACTATGCTGAGG - Intergenic
1198254127 X:134910457-134910479 ATATACAAGGCACTGTGCTAGGG + Intronic
1198282053 X:135151976-135151998 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198284354 X:135174963-135174985 ATATGCCAAGCACTGGGCTAAGG - Intergenic
1198288906 X:135220546-135220568 ATATGCCAAGCACTGGGCTAAGG + Intergenic
1198407961 X:136333986-136334008 AAATGTAAAGTACAAAGCTATGG - Intronic
1199516337 X:148680584-148680606 ATATGCAGAGTATGGTGCTAGGG + Intronic
1200366891 X:155675747-155675769 AAATGCAAAATATTATGCTTAGG + Intergenic
1201790185 Y:17831279-17831301 AAATGCAAACTACGATGCCATGG - Intergenic
1201811369 Y:18074710-18074732 AAATGCAAACTACGATGCCATGG + Intergenic
1202351831 Y:24001023-24001045 AAATGCAAACTACCATGCCATGG - Intergenic
1202518948 Y:25669096-25669118 AAATGCAAACTACCATGCCATGG + Intergenic