ID: 1144051485

View in Genome Browser
Species Human (GRCh38)
Location 17:11500787-11500809
Sequence ATAGCACTTTCTGAGATGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 221}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144051485_1144051489 -3 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051489 17:11500807-11500829 TATTGGACATAGATGGATTATGG 0: 1
1: 0
2: 0
3: 5
4: 114
1144051485_1144051488 -10 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051488 17:11500800-11500822 AAAGTGCTATTGGACATAGATGG 0: 1
1: 0
2: 2
3: 22
4: 221
1144051485_1144051495 29 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051495 17:11500839-11500861 GGGTCTACAGGGAAACTGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 183
1144051485_1144051493 18 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051493 17:11500828-11500850 GGATTATACTTGGGTCTACAGGG 0: 1
1: 0
2: 0
3: 8
4: 75
1144051485_1144051494 25 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 134
1144051485_1144051490 8 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051490 17:11500818-11500840 GATGGATTATGGATTATACTTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1144051485_1144051491 9 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051491 17:11500819-11500841 ATGGATTATGGATTATACTTGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1144051485_1144051492 17 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051492 17:11500827-11500849 TGGATTATACTTGGGTCTACAGG 0: 1
1: 0
2: 1
3: 5
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144051485 Original CRISPR ATAGCACTTTCTGAGATGAT GGG (reversed) Intronic
900779250 1:4606849-4606871 ATACCACTTTCTGAGCTCCTGGG + Intergenic
907150625 1:52283742-52283764 AGAAAACTTTCTGAGATGAGAGG + Intronic
907742738 1:57183050-57183072 CAAGGACTTTCTGTGATGATGGG - Intronic
908900710 1:68953203-68953225 ATAGCACTTGCGGAGAACATGGG + Intergenic
909016775 1:70388552-70388574 ATGGAACTTTCTGTGATGATGGG + Intergenic
909305921 1:74076256-74076278 ATAGATCTTTCTGAGATCTTTGG + Intronic
909938484 1:81582680-81582702 ATAGTACTTGCTGACATCATTGG - Intronic
910592297 1:88939207-88939229 ATAGCACTTTATAATATTATGGG - Intronic
916709819 1:167394519-167394541 TTAAAACTTTCTGTGATGATGGG + Intronic
919275491 1:195409835-195409857 AGAGTACTTTTTGAGGTGATAGG + Intergenic
919550871 1:198985197-198985219 GTTGCACTTTCTGAAATGATAGG - Intergenic
920676435 1:208041518-208041540 ATAGAACCTTCTGCGATAATGGG + Intronic
922343745 1:224678679-224678701 ATAGCACTTTCTGTGGTGATGGG + Intronic
922924070 1:229332844-229332866 ACAGCTCTCTCTGTGATGATGGG - Intronic
923747440 1:236715467-236715489 GTAGAATTTTCTGTGATGATAGG + Intronic
1063492136 10:6473926-6473948 ATAGCACTTGCAGAGAAGTTTGG - Intronic
1063541662 10:6940242-6940264 ATAGTACTTTCTCTGAAGATGGG + Intergenic
1066503210 10:36014932-36014954 AGAGCACTTTTTGAAAAGATAGG - Intergenic
1066967243 10:42280576-42280598 AAAGCACTTTCAGAAATGAATGG - Intergenic
1067735596 10:48847861-48847883 ATATTAATTTCTGAGATGAACGG - Intronic
1069375083 10:67785535-67785557 ATAGAAGTTACTGAGATGATGGG + Intergenic
1071232039 10:83599503-83599525 ATTGAACATTCTGTGATGATTGG - Intergenic
1073861528 10:107748242-107748264 AAAGAACATTCTGGGATGATAGG + Intergenic
1075121313 10:119666864-119666886 AAAGAGCTTTCTGAGGTGATGGG - Intronic
1075182455 10:120224162-120224184 ATAGCACTTGCTGAAATTTTTGG + Intergenic
1075649420 10:124117856-124117878 GTAGAACTTTCTGCGATAATGGG + Intergenic
1076295064 10:129377778-129377800 ATAGAACTTTCTGCTCTGATGGG - Intergenic
1077508881 11:2945103-2945125 ACAGCCCTTTCTGAGATGATCGG + Exonic
1078486508 11:11728023-11728045 ATAGAACTTTCTGTGAAGAGGGG - Intergenic
1078644115 11:13123144-13123166 GTAGCACTCTCTTACATGATTGG + Intergenic
1078741871 11:14074023-14074045 AAAGCACTGTTGGAGATGATGGG + Intronic
1079016061 11:16869970-16869992 ATAGAACTGTCTCAGATGAATGG + Intronic
1079524190 11:21364449-21364471 ATAGCATTTTGTGATAGGATAGG - Intronic
1079540792 11:21571828-21571850 ATGGAACATTCTGAGTTGATTGG + Intronic
1080673504 11:34402945-34402967 ACAGAACTTTCTGCAATGATGGG + Intergenic
1081080764 11:38736774-38736796 ATAGAACTTTCTGTGAGTATGGG - Intergenic
1082718541 11:56644484-56644506 ATGGCACTGTCTGTGATAATAGG - Intergenic
1083478775 11:62930265-62930287 AGAGCAGTTTCTGAGATTCTGGG + Intergenic
1085851273 11:80123270-80123292 ATAGCACATTTTAAGATGTTTGG + Intergenic
1086037496 11:82434436-82434458 AAAAAACTTTCTGTGATGATGGG + Intergenic
1086473714 11:87146661-87146683 ACAGCACTTTTTGAGATTAACGG - Intronic
1086818038 11:91398285-91398307 ATATCACTTTTGGAGATAATAGG + Intergenic
1086870877 11:92035079-92035101 ACAGAACTTTCTGAAATGCTAGG - Intergenic
1087531739 11:99390798-99390820 ATAACAATTTATGATATGATGGG - Intronic
1088854703 11:113737591-113737613 ACAGCAATTTCTGAGGTCATTGG - Exonic
1091467086 12:694212-694234 GTAGAACTTTCTAAGATGAGGGG - Intergenic
1091825994 12:3513237-3513259 AGAGAACTTTCTGAGACGACTGG - Intronic
1092837134 12:12501288-12501310 ATAGTGCTTGCTGAGATGAACGG - Intronic
1093005338 12:14045022-14045044 ACAGAACTTTCTGCAATGATGGG + Intergenic
1093574764 12:20713693-20713715 ACAGAACTATCTGTGATGATCGG + Intronic
1093777844 12:23098205-23098227 AAAGAACTTTCTGAGCTTATGGG - Intergenic
1094119998 12:26962011-26962033 GTAGAACTTTCTGAAATGATTGG + Intronic
1095855653 12:46857944-46857966 ATAATACTTTCTGAGAAGCTAGG - Intergenic
1096047796 12:48579630-48579652 CTATCACTTTCGGGGATGATAGG - Intergenic
1096673260 12:53212878-53212900 GTAGAACTTTCTGCAATGATGGG - Intronic
1097338790 12:58414405-58414427 ATAGAACTTTCTATAATGATTGG + Intergenic
1098064049 12:66593665-66593687 TTAGCACTTTCTCTGATGAATGG - Intronic
1098659499 12:73074812-73074834 ACAGTACTTTCAGAGATGGTGGG + Intergenic
1099725637 12:86424321-86424343 AGTGCACTTCCTGTGATGATTGG - Intronic
1101237940 12:102808547-102808569 ACAAAACTTTCTGTGATGATGGG - Intergenic
1101648829 12:106656358-106656380 ATAGAACTTTCTGTGATGCTGGG - Intronic
1101747636 12:107555774-107555796 ATAGAAGTTTCTGTGATGATGGG - Intronic
1103108002 12:118247072-118247094 ATAGAACTTTCTTTGATGATGGG + Intronic
1103445553 12:120992905-120992927 ACAGCACTTTATGAGAAGAGAGG - Intronic
1103454615 12:121055004-121055026 ATAGAATTTTCTATGATGATAGG - Intergenic
1105654950 13:22426406-22426428 ATAGCACTTTCTAACTTGTTTGG - Intergenic
1107149261 13:37092573-37092595 TTAGCTCTGTCTGAGGTGATCGG + Intergenic
1108447538 13:50524969-50524991 ATATCACAGTCTGAGATGCTGGG - Intronic
1108743496 13:53364207-53364229 TTAACACTTTCTGAAATTATAGG - Intergenic
1110191977 13:72740548-72740570 AGAACATTTTCTGTGATGATGGG - Intronic
1111088172 13:83404040-83404062 ATATCAGTTTCTTAGATGAATGG + Intergenic
1113126665 13:106986830-106986852 TTTGCACTTTCTGAGATAACCGG + Intergenic
1116226540 14:42160853-42160875 TTAGTATTTTCTCAGATGATAGG + Intergenic
1117513895 14:56481229-56481251 ATAGCACTTTCTTATAAAATAGG - Intergenic
1117705793 14:58466347-58466369 ATAGCAATCTCTGAAATGATGGG + Intronic
1119753380 14:77097216-77097238 ATATAACTTTCTGCGATGCTGGG + Intergenic
1120333666 14:83126170-83126192 AAATCACTTTCTAAGATGTTTGG + Intergenic
1120388097 14:83870784-83870806 ATAGGACTTTCTGAGGTGTTGGG + Intergenic
1120721517 14:87894175-87894197 GAACCACTTTCTGAGATGGTTGG - Intronic
1123187756 14:106536729-106536751 ATCGCACTCTTTGAGATGCTGGG + Intergenic
1123797844 15:23791559-23791581 AGAGTATTTTCTGAGTTGATGGG + Intergenic
1125021284 15:34988949-34988971 ATACAACTTTATGAAATGATAGG + Intergenic
1126043006 15:44610811-44610833 ATAGCACTTTATGACAAAATAGG - Intronic
1126889677 15:53191096-53191118 ATAGCCTTTTCTAATATGATGGG + Intergenic
1126941791 15:53775352-53775374 ATAGCACACTCTGACATGAAGGG + Intergenic
1128036490 15:64531154-64531176 TTAGCACTTTGTGATATTATGGG + Intronic
1128529423 15:68433558-68433580 ATTGCCCTTTCTGAAACGATGGG - Intergenic
1129147049 15:73657643-73657665 ATAGAACTTTCTGTGATGACAGG - Intergenic
1129609727 15:77043608-77043630 ATAGCTTTGTCTGTGATGATAGG - Exonic
1131550823 15:93355378-93355400 ACAGCACTCTCTGGGATGATGGG + Intergenic
1131849023 15:96517849-96517871 ATAGCACTGTCAGACATGGTAGG - Intergenic
1132228869 15:100166982-100167004 ATAAAACTTTCTGCGATGACGGG + Intronic
1132835795 16:1952784-1952806 CTAGCTCTTGCTGAAATGATAGG - Intronic
1133657894 16:7884230-7884252 ATAGAACTTTCTGTGATGATGGG + Intergenic
1134843425 16:17420101-17420123 GTAGCACTTTCTAAGATGAAAGG - Intronic
1135397862 16:22144944-22144966 ATAGCAATTGCTGAGAAGATTGG + Intronic
1139932970 16:70544497-70544519 TTAGGACTCTCAGAGATGATCGG - Exonic
1203013562 16_KI270728v1_random:326308-326330 AAAGGACTTTGTGAGATGAATGG - Intergenic
1203031897 16_KI270728v1_random:599467-599489 AAAGGACTTTGTGAGATGAATGG - Intergenic
1203039824 16_KI270728v1_random:734964-734986 AAAGGACTTTGTGAGATGAATGG + Intergenic
1143444586 17:6999971-6999993 AGAGCATTTGCTGAGCTGATAGG + Intronic
1144051485 17:11500787-11500809 ATAGCACTTTCTGAGATGATGGG - Intronic
1144310022 17:14005177-14005199 ATAGCATTTTATGAGAAGATTGG + Intergenic
1144442205 17:15293696-15293718 ATAGGGCTTTCTGCAATGATGGG - Intergenic
1144511901 17:15884265-15884287 GTAGAACCTTCTGTGATGATGGG + Intergenic
1144648267 17:16990191-16990213 ATGGAACTTTCTGGGATGGTTGG - Intergenic
1146000345 17:29126866-29126888 AGAACACTTTCTGGGAAGATAGG + Intronic
1146970067 17:37065351-37065373 ATAGAACTTTCTAGGATGATGGG + Intergenic
1148148020 17:45378248-45378270 GTACCATTTTCTGAAATGATGGG + Intergenic
1149826980 17:59837552-59837574 ACAGCTTGTTCTGAGATGATTGG - Intronic
1150055794 17:62014270-62014292 CTAGAACTTTCTATGATGATGGG + Intronic
1150352241 17:64454514-64454536 GTAGAACTTTCTGTGATGATGGG - Intronic
1150846630 17:68665520-68665542 AGGTCACATTCTGAGATGATGGG - Intergenic
1151492958 17:74443525-74443547 AGAGCATTTTCTGAGCTGTTGGG + Intronic
1151943820 17:77308438-77308460 ATAGAACCTTCTGTGATGGTGGG + Intronic
1153060632 18:991277-991299 ATGGCACATTCTGAGGTGCTGGG + Intergenic
1154385805 18:13890870-13890892 GAAGCAATTGCTGAGATGATGGG + Intronic
1155791331 18:29974270-29974292 ATAGAACTTTCTGTAAAGATAGG + Intergenic
1156542977 18:37934725-37934747 AAAAAACTTTCTGGGATGATAGG + Intergenic
1159169824 18:64751576-64751598 AATGCACTTTCAGAGTTGATGGG - Intergenic
1159212201 18:65338935-65338957 ATAACACTTTCTGACTTAATTGG + Intergenic
1161708805 19:5835481-5835503 ACAGAACTTTCTGTGATGATGGG + Intronic
1162162072 19:8725771-8725793 AAAGAACTATCTGAGATGATTGG + Intergenic
1163277920 19:16297084-16297106 TGAGGACTTTCAGAGATGATTGG - Intergenic
1163340895 19:16706362-16706384 ACAGAACTTTCTGTAATGATGGG - Intergenic
1164036992 19:21464085-21464107 ATAGCCCTTCCTGAAATGACTGG - Intronic
1164795030 19:31019399-31019421 ATAGACCTTTCTGTGGTGATGGG + Intergenic
1167225065 19:48232748-48232770 AGAGAACTTTCTGTGATGACGGG - Intronic
1167265733 19:48482308-48482330 AGATCACATTCTGAGATGCTGGG - Intronic
1167297933 19:48662761-48662783 AATGCACTTTCTGAGAGGCTGGG + Intronic
925762634 2:7200350-7200372 ATCGCACTTACTCATATGATGGG + Intergenic
925768912 2:7263571-7263593 ATAGCACACTATGTGATGATAGG + Intergenic
925811038 2:7701038-7701060 ATAGAACTTTCTATGATAATGGG - Intergenic
926188834 2:10712280-10712302 ATAGAACTCTCTGTGATGACTGG - Intergenic
926765100 2:16317456-16317478 ATTCCATATTCTGAGATGATGGG + Intergenic
926893208 2:17656730-17656752 GTAGTACTTTCTCTGATGATGGG + Exonic
929677103 2:43946845-43946867 AAAGCTCTTTCTGAGATAAAGGG - Intronic
931062019 2:58540801-58540823 AGAGCACTTTCTGGGCTGAGAGG + Intergenic
931097440 2:58957200-58957222 ATATCACTCTTTGAGATGTTGGG - Intergenic
934312401 2:91879334-91879356 AAAGCACTTTCAGAAATGAATGG + Intergenic
939442821 2:142271958-142271980 ATACCACTTTGAGAGATTATTGG + Intergenic
939739110 2:145884419-145884441 ATAGAAATTTCTATGATGATGGG - Intergenic
940816612 2:158304270-158304292 AAAGCAAGTTCTCAGATGATGGG + Intronic
941421408 2:165286802-165286824 ATAGAAATTTCAGAGATAATTGG - Intronic
942578285 2:177389650-177389672 AGAGCACTTTCCAAGATGATGGG - Intronic
944651287 2:201832773-201832795 CTAGGACTTTCAGAGATGCTAGG - Intronic
946159748 2:217828857-217828879 TTAGTACTTTCTGTGTTGATAGG + Intronic
946584676 2:221171770-221171792 ATAGCACTTAGTGTGAAGATGGG - Intergenic
947303236 2:228713294-228713316 ATTGCCATTTCTGACATGATTGG + Intergenic
947350589 2:229240061-229240083 ATAACACTTTCAGAGTTGAATGG - Intronic
1169850565 20:10045300-10045322 ATAGAACTTTTGGTGATGATGGG + Intronic
1175038498 20:56022932-56022954 GCAGAACTTTCTGGGATGATGGG + Intergenic
1176324752 21:5382526-5382548 ATTGAACTTTGTGAGATGAATGG - Intergenic
1176482306 21:7312942-7312964 ATTGAACTTTGTGAGATGAATGG - Intergenic
1178605501 21:34033208-34033230 AGAGAACTTTCTGAGGTGATAGG - Intergenic
1179067060 21:38034946-38034968 ATAGAACTTTCTGAAATTATGGG - Intronic
1180539156 22:16425165-16425187 AAAGCACTTTCAGAAATGAATGG + Intergenic
1181850507 22:25746627-25746649 ACACAACTTTCTGCGATGATAGG + Intronic
1181919169 22:26306525-26306547 ATATTAGTTTCTGACATGATAGG + Intronic
1182407515 22:30149454-30149476 TTAGAACTTTCTGTGATGATGGG - Intronic
950023866 3:9807648-9807670 ATGGAACTTTCTGCAATGATGGG - Intronic
950933022 3:16809996-16810018 CTACCATTTGCTGAGATGATTGG - Intronic
952206841 3:31188722-31188744 ATAGCACTTTCCTAGATAACGGG - Intergenic
952244301 3:31568953-31568975 ATAGAACTTTATGAGCTGGTAGG - Intronic
953663683 3:44909895-44909917 ATAGCACATTCTGACATCAGTGG - Intronic
954952490 3:54487907-54487929 ACAGCACTTTGTATGATGATGGG - Intronic
955293963 3:57718589-57718611 ATAGAACTTTATGTGATGATAGG - Intergenic
955492718 3:59499310-59499332 AGAGGACTTTGTGAGATGCTGGG + Intergenic
956084368 3:65594563-65594585 ATAGCATTTTTTGAGATGTCTGG - Intronic
959391933 3:105786041-105786063 ATAACACTGTGTGAGAGGATCGG + Intronic
959975920 3:112459598-112459620 ATGGCACATTCTGAGATTGTTGG - Intergenic
960884305 3:122378976-122378998 GTAGGACTTTCTGTGATGGTGGG - Intronic
961614247 3:128166318-128166340 GCAGAACTTTCTGTGATGATAGG + Intronic
964923054 3:161921256-161921278 AAAGCACTTTCTAAGAAGACAGG - Intergenic
965481239 3:169222126-169222148 ATAGAACTTTCTGTGACGATGGG - Intronic
967251881 3:187548181-187548203 ATATGACTTTCTGAGATACTGGG - Intergenic
967451343 3:189626836-189626858 ACAGCCCTTTCTGAGATGTGTGG + Intergenic
971319385 4:25593047-25593069 CTAGCACATTCTGAGAAGGTTGG + Intergenic
972369712 4:38411159-38411181 ATTGAACTCTCTGTGATGATGGG - Intergenic
975802152 4:78071590-78071612 GTAGAGCTTTCTGTGATGATGGG + Intronic
977944599 4:102897372-102897394 AAAGCACTTTCAGAAATGAATGG + Intronic
981410668 4:144426474-144426496 GTAGAACTTTCTGTGCTGATGGG - Intergenic
981660383 4:147159293-147159315 ATAGTACTTTATGAGATTGTTGG + Intergenic
981945979 4:150344668-150344690 ATAGCCCTAGCTGAGATGAGAGG - Intronic
982661972 4:158218272-158218294 ATAGAACTTTGTGTAATGATGGG - Intronic
985975775 5:3418112-3418134 AGAGCACATTCTGAGATGCTGGG - Intergenic
986196303 5:5539181-5539203 ATATCACTTCCGCAGATGATGGG + Intergenic
988433150 5:31143325-31143347 ATGCCACTTTCTGGGATGATTGG + Intergenic
989066861 5:37472246-37472268 AGAGAACTTTCTGAGGAGATGGG - Intronic
990199023 5:53350227-53350249 ATTCCACTTTCTGAGATGTGAGG - Intergenic
991388821 5:66120655-66120677 ATAGGACTTACTGAAATGATGGG + Intergenic
992391469 5:76335139-76335161 GTAGCACTTTTGGTGATGATGGG - Intronic
992596672 5:78353994-78354016 ATAGCAATTTGTGAATTGATTGG + Intergenic
993882746 5:93381846-93381868 ATAAAACTGTCTGAGATGATGGG + Intergenic
994384554 5:99114515-99114537 CTAGAACTTACTGTGATGATGGG + Intergenic
994630778 5:102284714-102284736 ATAGTACTTTCAGAAATGTTTGG + Intronic
995382594 5:111551262-111551284 ATAGCACTTCCTGAGGAAATGGG - Intergenic
995604791 5:113841600-113841622 AAATCACTTTCTGATATGAAGGG + Intergenic
995909176 5:117164969-117164991 ATAGAAAATTCTGAGCTGATAGG + Intergenic
998175385 5:139898677-139898699 ATAGCTCTTTGTGAAAGGATGGG - Intronic
999000252 5:147913110-147913132 ATAGCACTTTGTGAGAAAATCGG - Intergenic
999813314 5:155149714-155149736 AGGGAACTTTCTGAGGTGATGGG + Intergenic
999926795 5:156387678-156387700 AAATAACTTTCTGAGATGTTGGG + Intronic
1001126216 5:169021962-169021984 ATAGAACTTTCTGTGATGATGGG - Intronic
1002713849 5:181212810-181212832 ATAGCACTTTCAGAAATCCTGGG + Intergenic
1005065058 6:21809754-21809776 ATAAAACTTACTGAAATGATTGG + Intergenic
1006040221 6:31246396-31246418 ACTGCACTTTCTGGGGTGATTGG - Intergenic
1009532671 6:64840949-64840971 ATACAACTTTCTGTTATGATGGG - Intronic
1011887486 6:92115001-92115023 ATAGAGGCTTCTGAGATGATTGG + Intergenic
1012491129 6:99783578-99783600 ACAGCACTTTCTGGGATTAAGGG - Intergenic
1018422224 6:163649407-163649429 ATTGCACTTGCAGAGATGGTGGG - Intergenic
1019863394 7:3682164-3682186 CTACCACTCTGTGAGATGATAGG + Intronic
1021361494 7:19718448-19718470 ATGGATCTTTCTGAAATGATGGG + Intergenic
1024689062 7:51779981-51780003 ATAGCCCATTCTGAGGTGATAGG + Intergenic
1025526874 7:61824712-61824734 AAAGGACTTTGTGAGATGAATGG + Intergenic
1027621343 7:80490344-80490366 ACAGAACTTTGTGGGATGATAGG - Intronic
1029158749 7:98535972-98535994 ATGTCACATTCTGAGGTGATAGG - Intergenic
1029320334 7:99753158-99753180 ATAGGACTTTGTGAGGGGATAGG - Intergenic
1030499951 7:110347761-110347783 ATCCCACTTTCTCAGCTGATGGG + Intergenic
1031506030 7:122584724-122584746 ATAGCACTTTCTAAATTTATGGG - Intronic
1032502993 7:132413986-132414008 ATAGCTCTATCTGCCATGATTGG - Intronic
1035588739 8:797176-797198 ACAGGACTTTCGGAGATGACGGG - Intergenic
1036060912 8:5319254-5319276 ATAGAACTTTTTGAGTTTATTGG + Intergenic
1036737651 8:11332019-11332041 GTGGCACTTTCTGACATCATGGG + Exonic
1036918367 8:12827484-12827506 ATAGCAGTGGCTGAGATAATAGG + Intergenic
1037318469 8:17621697-17621719 ATAGAACTTTCTGTGATAAAGGG - Intronic
1037719364 8:21429790-21429812 ATGGCAGTTTCTGAGCTGATGGG + Intergenic
1038935329 8:32243532-32243554 ATATCACATTCTGAGGTGCTGGG + Intronic
1040776667 8:51052006-51052028 TTATTACTTTCTGATATGATAGG + Intergenic
1041838881 8:62247630-62247652 ACAGCCTTTTCTGAGATAATTGG + Intergenic
1042413915 8:68497777-68497799 ATTGCACTTACTTAGATGAATGG - Intronic
1043289267 8:78576496-78576518 ATAGAAGTTTCTGTGATAATGGG + Intronic
1043596628 8:81895195-81895217 ATGTAACTTTCTAAGATGATGGG - Intergenic
1044886488 8:96783673-96783695 ATAGAACTTTCTGTCATGATAGG + Intronic
1045114035 8:98963560-98963582 AAAGAACTGTCTGAGAGGATAGG - Intergenic
1045651365 8:104344465-104344487 ATAGAACTGTCTGTGATGCTGGG - Intronic
1046063610 8:109170530-109170552 TAAGCACTTACTGAGATGAATGG - Intergenic
1052033353 9:23653313-23653335 ATAGCCCTTTATCAGATAATGGG + Intergenic
1054667862 9:67753998-67754020 ATAGCATTATCTAAGAAGATGGG + Intergenic
1056761298 9:89417308-89417330 ACAGCACTTTCTGTGCTTATTGG - Intronic
1057524944 9:95790507-95790529 GTAGAACTTTCTGTGCTGATGGG - Intergenic
1058153741 9:101488836-101488858 ATAGAACTTTCTGTGATGATGGG - Intronic
1058738981 9:107923672-107923694 ATAGAACTTTCTGGGATGAGTGG + Intergenic
1059254781 9:112919759-112919781 ATAGAAATTTCTTAGATGAAAGG - Intergenic
1059964986 9:119604787-119604809 AGAGCACATTCTGAGATTCTAGG - Intergenic
1060137836 9:121174501-121174523 ACAGAACTTTCTGCAATGATGGG - Intronic
1187053477 X:15717404-15717426 ATGGGACATTCTGTGATGATGGG + Intronic
1189145356 X:38649868-38649890 CTAGCACTTGCTGATAAGATGGG + Intronic
1189762213 X:44333261-44333283 ATGGTTCTTGCTGAGATGATCGG + Intronic
1192005711 X:67209865-67209887 ATAGCACCGACTGAGAAGATAGG - Intergenic
1192469484 X:71385105-71385127 ATAGTTCTTTCTGAGCTGACTGG - Intronic
1193587103 X:83337735-83337757 ATAGCACTTTTTTAAATTATTGG - Intergenic
1193866961 X:86744964-86744986 ATAGCAGTTTGAGAGATGAGTGG - Intronic
1195160301 X:102164152-102164174 AAAGCACTTTCTGGGAACATGGG + Intergenic
1196335918 X:114534101-114534123 ATAGAACTTTCTGCAATGATTGG + Intergenic
1197153328 X:123243931-123243953 ATAGCAATGTCAGAGATGACGGG - Intronic
1197825354 X:130584371-130584393 AGATCACATTCTGAGATTATGGG + Intergenic
1197857441 X:130931362-130931384 AAAACATTTTCTGAGATCATAGG + Intergenic
1198384521 X:136115933-136115955 CTAGCAATTGCTGAGCTGATGGG + Intergenic
1198808990 X:140516101-140516123 AGAGCACTCACTGAGATGATGGG + Intergenic
1199000104 X:142625528-142625550 ATGGCACTTTCTAAGGTTATCGG + Intergenic
1201180360 Y:11336825-11336847 AAAGCACTTTCAGAAATGAATGG + Intergenic