ID: 1144051486

View in Genome Browser
Species Human (GRCh38)
Location 17:11500788-11500810
Sequence AATAGCACTTTCTGAGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1050
Summary {0: 1, 1: 13, 2: 63, 3: 247, 4: 726}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144051486_1144051494 24 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 134
1144051486_1144051491 8 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051491 17:11500819-11500841 ATGGATTATGGATTATACTTGGG 0: 1
1: 0
2: 3
3: 19
4: 154
1144051486_1144051489 -4 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051489 17:11500807-11500829 TATTGGACATAGATGGATTATGG 0: 1
1: 0
2: 0
3: 5
4: 114
1144051486_1144051492 16 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051492 17:11500827-11500849 TGGATTATACTTGGGTCTACAGG 0: 1
1: 0
2: 1
3: 5
4: 101
1144051486_1144051490 7 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051490 17:11500818-11500840 GATGGATTATGGATTATACTTGG 0: 1
1: 0
2: 0
3: 6
4: 93
1144051486_1144051493 17 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051493 17:11500828-11500850 GGATTATACTTGGGTCTACAGGG 0: 1
1: 0
2: 0
3: 8
4: 75
1144051486_1144051495 28 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051495 17:11500839-11500861 GGGTCTACAGGGAAACTGGAAGG 0: 1
1: 0
2: 1
3: 21
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144051486 Original CRISPR AATAGCACTTTCTGAGATGA TGG (reversed) Intronic
900210497 1:1453450-1453472 CATAGCACTTTCTGAGGCCAAGG - Intronic
901346008 1:8543084-8543106 AATAGAACTTTCTGCTGTGATGG - Intronic
901658514 1:10784337-10784359 AACAGAACTTCCTGCGATGATGG + Intronic
901715867 1:11153639-11153661 AATAGAGCTTTCTGTGATGATGG + Intronic
901900706 1:12359362-12359384 TGTAGAACTTTCTGTGATGATGG + Intronic
902214669 1:14926874-14926896 ATTGGCACTTTCAGAGATGTGGG + Intronic
902273091 1:15318765-15318787 AATAGGACTTGCTGTGCTGATGG - Intronic
902457285 1:16543962-16543984 AACAGGCCTTTCTCAGATGATGG + Intergenic
902483934 1:16729305-16729327 AACAGGCCTTTCTCAGATGATGG - Intergenic
902494881 1:16863950-16863972 AACAGGCCTTTCTCAGATGATGG - Intronic
902778257 1:18688544-18688566 AATAGAAGTTTCTGCGATGACGG - Intronic
902809253 1:18879143-18879165 AGTAGAACTTTTTGTGATGAGGG - Intronic
902882321 1:19380592-19380614 AACAGAACTTCCTGAGACGATGG + Intronic
902893569 1:19462979-19463001 ACTGGAACTTTCTGTGATGATGG - Intronic
903123767 1:21233910-21233932 AATAGAACCTCCTGCGATGATGG + Intronic
903308512 1:22432597-22432619 AACAGGACTTTCTGCAATGAAGG - Intergenic
903477827 1:23632356-23632378 AGTAGAACTTTCTGGGATGATGG + Intronic
903503918 1:23819343-23819365 ACCAGCACTTTCTGTGAAGATGG - Intronic
903593217 1:24473040-24473062 AGTAGAACTTTCTGCGATGATGG + Intergenic
903636967 1:24826644-24826666 AAGAGAACTTTCTGTGATGATGG - Intronic
903751626 1:25625392-25625414 AAAGGAACTTTCTGAGATGATGG - Intronic
904129438 1:28264783-28264805 AACAGAATTTTCTGCGATGATGG - Intronic
904253900 1:29242447-29242469 AATAGAACCTTCTGTGGTGATGG + Intronic
904758537 1:32783922-32783944 AACAGTACTTTCTGTGGTGATGG - Intronic
904776635 1:32912552-32912574 AATAGAACTTTCTGTAATGAGGG + Intergenic
905270559 1:36784712-36784734 AAGACCTCTTGCTGAGATGATGG + Intergenic
905360187 1:37413733-37413755 AATAGAACTTTCTGCCATGATGG + Intergenic
906203253 1:43973269-43973291 AATAGAACTTTCTGCCATGATGG - Exonic
906612208 1:47211499-47211521 AATAGAACTTTTTGTGATGATGG - Intergenic
906831834 1:49040794-49040816 AAGGGAACTTTTTGAGATGATGG + Intronic
907252243 1:53147253-53147275 AGTAGAACTTTCTGTGATCATGG - Intergenic
907678632 1:56542380-56542402 AAAAGCACTTTGTGAGAAGGAGG - Intronic
907742739 1:57183051-57183073 ACAAGGACTTTCTGTGATGATGG - Intronic
908018520 1:59874242-59874264 AATAGAACTTTCTGCAATGATGG - Exonic
908103208 1:60812468-60812490 AAAAGAACTTTCTATGATGATGG + Intergenic
908183625 1:61630453-61630475 CATAGAATTTTCTGTGATGATGG - Intergenic
908262373 1:62349299-62349321 ACTAGTACTTTCTGTAATGATGG - Intergenic
908447479 1:64214172-64214194 AGTAGCACTTTCTGCATTGATGG + Intronic
908509920 1:64843315-64843337 AATTGCAGTCACTGAGATGAAGG + Intronic
908748309 1:67396512-67396534 AACAGAACTTCCTGAGATGATGG + Exonic
908854262 1:68406691-68406713 AGTAGAACTTTCGGTGATGATGG - Intergenic
908857013 1:68442108-68442130 AATAGAACTTTCTGCAATAATGG - Intronic
908959075 1:69672373-69672395 AATAGAACTTTCTGCAATGATGG - Intronic
909016774 1:70388551-70388573 AATGGAACTTTCTGTGATGATGG + Intergenic
909221055 1:72962340-72962362 AATAACAATTTCTGAAATTAAGG + Intergenic
909437310 1:75657296-75657318 ACCAGCACTTTTGGAGATGAAGG + Intergenic
909937295 1:81567368-81567390 AATATAACTTTCTGTGATGACGG - Intronic
910404565 1:86873438-86873460 AATAGAACTTTCTGAGATAAAGG + Intronic
910592298 1:88939208-88939230 AATAGCACTTTATAATATTATGG - Intronic
910956230 1:92709195-92709217 AAAGGAATTTTCTGAGATGATGG + Intronic
911055371 1:93704064-93704086 TATGGCAATTTCTGTGATGATGG - Intronic
911627285 1:100138862-100138884 AACAGAACTTTCTGCAATGATGG - Intronic
911631609 1:100189860-100189882 AATAGAATTTTCTGTGATGATGG + Exonic
912132694 1:106621125-106621147 AGTAGAACTTTTTGAGATCATGG - Intergenic
912229838 1:107779997-107780019 AATAGAACTTTCTGTGATGATGG - Intronic
912282988 1:108336883-108336905 GATAGAACTTTCTGTGATGGTGG + Intergenic
912304376 1:108551542-108551564 AATAGAACTTTCTGCAATAATGG - Intergenic
912356735 1:109060330-109060352 AAAAGAATTTTCTGTGATGATGG + Intergenic
912378419 1:109231866-109231888 AATAGGACTTTCTGCGATGATGG + Intronic
912378537 1:109233034-109233056 AATAGAACTTTCTGCACTGATGG + Intronic
912718374 1:111999235-111999257 AACAGCACTTTCCATGATGACGG - Intergenic
912915388 1:113809913-113809935 GATAGAACTTTCTCAGATGATGG - Intronic
913013783 1:114711824-114711846 AACAGTACTTTATGTGATGATGG + Intronic
913662271 1:121014852-121014874 AACAGGCCTTTCTCAGATGATGG + Intergenic
914013648 1:143798037-143798059 AACAGGCCTTTCTCAGATGATGG + Intergenic
914164178 1:145163150-145163172 AACAGGCCTTTCTCAGATGATGG - Intergenic
914259892 1:145990096-145990118 AATAGAACTTTCTATGATGATGG - Intergenic
914652272 1:149706646-149706668 AACAGGCCTTTCTCAGATGATGG + Intergenic
915391167 1:155545291-155545313 AATATTACTTTCTAAAATGATGG - Intronic
915406142 1:155660967-155660989 AATAGGACTTTCTAAGTTTAGGG + Intronic
915422633 1:155796712-155796734 AACAGAACTTTCTGTGATGATGG + Intronic
916001507 1:160620755-160620777 AACAGAACTTTCTGAGATGATGG + Intronic
916409418 1:164530768-164530790 AATAGATCATTCTGAGCTGAAGG - Intergenic
916494327 1:165331327-165331349 AATACAACTTTCTGCAATGATGG + Intronic
916531216 1:165658515-165658537 AACAGAACCTTCTGACATGATGG + Intronic
916705398 1:167344199-167344221 AATAGAACTTTCTGTGATAATGG - Intronic
916709818 1:167394518-167394540 ATTAAAACTTTCTGTGATGATGG + Intronic
916758938 1:167799649-167799671 AATAGAACTTTCTGCAATGAAGG - Intergenic
916915144 1:169398744-169398766 AATAGAACTTTCTGGGATGATGG - Intronic
917163626 1:172086445-172086467 AATAGAACTTTCTGAGATGATGG + Intronic
917163653 1:172086806-172086828 AATAGAAGTTTCTGAGATGATGG + Intronic
917327538 1:173848389-173848411 AATAAAACTTTCTGTAATGATGG + Intronic
917940627 1:179917398-179917420 AATACCACTTTCTTAGATTCAGG - Intronic
918156832 1:181855731-181855753 AATAGAACCTTCTGTGATGAAGG - Intergenic
918367154 1:183820480-183820502 GATAGCACCATATGAGATGAGGG + Intronic
918567094 1:185947221-185947243 AATAGGACTTTCTGCAATGATGG + Intronic
918909585 1:190549002-190549024 AATAAAACTCTCTGTGATGATGG - Intergenic
918915684 1:190634063-190634085 CATGGCACTTTCTGCCATGAGGG - Intergenic
919084583 1:192906732-192906754 AATAGAAATTTCTAAGATGATGG - Intergenic
919633359 1:199980556-199980578 AACAGAACTTTCTGGCATGATGG + Intergenic
919941855 1:202292715-202292737 AGTAGAACTTTCTGGGTTGACGG + Intronic
920073900 1:203323119-203323141 AAAAGCACTTGTTGAGATTATGG + Intergenic
920280269 1:204838125-204838147 AATAGAACTTTCTTTGATGATGG + Intronic
920289277 1:204906324-204906346 AAGAGAACTTTCTGGGATGATGG - Intronic
920676434 1:208041517-208041539 AATAGAACCTTCTGCGATAATGG + Intronic
921102144 1:211937757-211937779 AACAGAACTTTCTGTAATGATGG - Intergenic
921230883 1:213069204-213069226 AATAGAACTTTCTGTGATAACGG - Intronic
921281668 1:213573863-213573885 AACTGGACTCTCTGAGATGAAGG - Intergenic
921522910 1:216178706-216178728 AATAGAACTTTCTCCAATGAAGG + Intronic
921707126 1:218335479-218335501 AATAGGACTTTTTTTGATGATGG + Exonic
921881588 1:220260795-220260817 AATAGAACTTTCTGTAATCATGG + Intronic
921940735 1:220836439-220836461 AAAAGAACTTTCTGGGATCATGG + Intergenic
922198902 1:223384660-223384682 AACAGAACTTTCTGAGATAAGGG - Intergenic
922251534 1:223853466-223853488 AATAGAGCTTTCTGTGATGATGG - Intergenic
922267750 1:224001461-224001483 AATAACACTTTCTGAGATGATGG - Intergenic
922343744 1:224678678-224678700 GATAGCACTTTCTGTGGTGATGG + Intronic
922656664 1:227390650-227390672 AAGAGAACTTTCTGTAATGATGG - Intergenic
922988083 1:229882011-229882033 TCTAGCACTTTCGGAGATGGAGG - Intergenic
924518845 1:244788429-244788451 AATAAAACTTTCTGCAATGATGG - Intergenic
924681201 1:246235967-246235989 AGTAGTGCTTTCTGTGATGATGG - Intronic
1063433669 10:6013239-6013261 TATAGAACTTTCTGAGATGATGG + Intronic
1063540010 10:6923271-6923293 AGTAGAACTTTCTGGGATAAGGG + Intergenic
1063541661 10:6940241-6940263 AATAGTACTTTCTCTGAAGATGG + Intergenic
1064620178 10:17207424-17207446 GATAGAACTTTCTGTGATGATGG - Intergenic
1064893360 10:20206044-20206066 AAGATCAGTATCTGAGATGACGG + Intronic
1065062720 10:21923017-21923039 CATAGCACTTTCAGTTATGATGG - Intronic
1065551525 10:26872657-26872679 AGTAAGACTTTCTGTGATGATGG - Intergenic
1066121724 10:32295832-32295854 AATAGAACTTTCTATGATGATGG - Intronic
1066432597 10:35366714-35366736 ATTAGAGCTTTCTGTGATGATGG + Intronic
1066482514 10:35810863-35810885 AACAAAACTTTCTGTGATGATGG - Intergenic
1066725957 10:38394151-38394173 AATAACACTTTCTGAGATGATGG + Intergenic
1067361612 10:45586179-45586201 AAGAGAACTTTCTGTGGTGATGG - Intronic
1067841208 10:49680758-49680780 AATGGTACTTCCTGAGAGGATGG + Intronic
1067846181 10:49723548-49723570 CCTAGCACTTTGGGAGATGAAGG - Intergenic
1067916747 10:50408000-50408022 AGTAGAGCTTTCTGAGATGATGG + Intronic
1068946791 10:62737631-62737653 AATAGAACTTTCTGCAATGATGG - Intergenic
1069375082 10:67785534-67785556 TATAGAAGTTACTGAGATGATGG + Intergenic
1069656497 10:70093289-70093311 AATAGAACTTTCTGTGATCGTGG - Intronic
1069816959 10:71203083-71203105 AAGGGAATTTTCTGAGATGATGG + Intergenic
1069976936 10:72221496-72221518 AATAGAACTTTCTGCCATGATGG - Intronic
1070223201 10:74472770-74472792 GAGACCACTTTCTGCGATGATGG - Intronic
1070310376 10:75269044-75269066 AATAGAACCTTCTGTGATGATGG + Intergenic
1070546206 10:77454925-77454947 CATTGATCTTTCTGAGATGAGGG + Intronic
1073563269 10:104515118-104515140 GGTAGGACTTTCTGTGATGACGG + Intergenic
1073847510 10:107575095-107575117 AAAAGAATTTTCTGAGATGACGG + Intergenic
1073920781 10:108456074-108456096 AATAGAACTTTCTGCAATGATGG - Intergenic
1073923297 10:108483464-108483486 AATAGTAATTTCTGAGATTTTGG + Intergenic
1074094754 10:110301685-110301707 AGTAGAACTTTCTGTGATGATGG - Intronic
1074113474 10:110438543-110438565 AATGGAACTTTCTGCAATGATGG + Intergenic
1074736324 10:116437891-116437913 AATGGACCTTTCTGTGATGACGG - Intronic
1074752839 10:116603350-116603372 AACAGAACTTTCTGCAATGAGGG + Intronic
1074972881 10:118555415-118555437 AATAGTATTTTCTGTGATTATGG + Intergenic
1075061430 10:119259665-119259687 AATGGAACCTTCTGTGATGATGG + Intronic
1075512278 10:123082167-123082189 AATCCCACTCTCTGAGATGGGGG - Intergenic
1075597798 10:123744821-123744843 AATAGAACTTTCCGTGATGATGG - Intronic
1075966020 10:126612402-126612424 AATAGAACTTTCTACAATGATGG - Intronic
1076013431 10:127008441-127008463 AATAGAACTTTCTGTAATGATGG - Intronic
1076052894 10:127349347-127349369 AAAAGCATGTTCTGAGATGGAGG - Intronic
1076190252 10:128478158-128478180 AATAGATCTTTCTGCAATGATGG - Intergenic
1076488290 10:130838422-130838444 CAGAGCTATTTCTGAGATGAAGG + Intergenic
1077965950 11:7133743-7133765 AATAGCATTCCCTTAGATGAAGG - Intergenic
1078301851 11:10139354-10139376 AAAAGCATTTTCTGTAATGATGG + Intronic
1078486509 11:11728024-11728046 AATAGAACTTTCTGTGAAGAGGG - Intergenic
1078671899 11:13373131-13373153 AACAAGACTTTCTGTGATGATGG - Intronic
1078741870 11:14074022-14074044 AAAAGCACTGTTGGAGATGATGG + Intronic
1078778210 11:14412654-14412676 AATAGAACTTTCTGAAATGATGG - Intergenic
1079191792 11:18284126-18284148 AATAGAACTTTCTGTGATAGTGG - Intronic
1079464677 11:20718173-20718195 AATAGAACTTTCTGTGATGATGG + Intronic
1079476021 11:20830283-20830305 AAAAGCAGTTTCTCAGTTGAGGG - Intronic
1079948402 11:26771084-26771106 AATGGAACTTTCTGCAATGATGG + Intergenic
1080006222 11:27409975-27409997 AATAGAACTTTCTGCAATGATGG + Intronic
1080328175 11:31102826-31102848 AATAAAACTTTCTGTGATGATGG - Intronic
1080356037 11:31447048-31447070 AATAGAACTTTCTGAAATAATGG - Intronic
1080673503 11:34402944-34402966 AACAGAACTTTCTGCAATGATGG + Intergenic
1080730025 11:34941010-34941032 AATAGAAGTTTCTGTGGTGATGG + Intronic
1080753986 11:35177939-35177961 AATAGAACTTTCTGCAATGATGG - Intronic
1080758474 11:35225031-35225053 AATAGAACTTTCTGTGATGATGG + Intronic
1080954421 11:37076560-37076582 AACAGAACTTTCTGCAATGAAGG + Intergenic
1081819043 11:45973249-45973271 GATAGAACTTTCTGTGATGTTGG - Intronic
1081956062 11:47094768-47094790 AACAGAACTTTCTGTGATGATGG - Intronic
1084272655 11:68037436-68037458 AAAAGCACTTTTGGAAATGATGG - Intergenic
1085133075 11:74058954-74058976 AAAAGAACTTTCTGTTATGATGG - Intronic
1085358721 11:75865409-75865431 AATAAAACTTTCTGCAATGATGG + Intronic
1085819616 11:79778269-79778291 AATGGAACTTTCTGTGATGATGG + Intergenic
1086578308 11:88366163-88366185 AATAGAACTTTCTGTGATGATGG + Intergenic
1086781593 11:90912977-90912999 AATAGCAGTTAATGAGCTGATGG + Intergenic
1087030066 11:93693816-93693838 AGTAGCACTTTCTGTGATGATGG + Intronic
1087126897 11:94637314-94637336 TATAGAACTTTCTGTGATGATGG - Intergenic
1087265745 11:96058838-96058860 AGTAGCACTCTCAGAGATGTAGG - Intronic
1087444610 11:98234404-98234426 AAAAGAACTTTCTGAGATGATGG + Intergenic
1087523404 11:99274130-99274152 AATGGAACATTCTGTGATGATGG - Intronic
1087531740 11:99390799-99390821 AATAACAATTTATGATATGATGG - Intronic
1087924371 11:103902372-103902394 AATAGAACTTCTTGCGATGATGG - Intergenic
1088775043 11:113074501-113074523 AATAGCACTTTCTTTGATGAGGG + Intronic
1089815372 11:121168369-121168391 AATAGAACTCTCTGTGACGATGG + Intronic
1090191009 11:124768082-124768104 GATAGAACTTTCTGTGATGATGG + Intronic
1090260180 11:125313864-125313886 AATAGAACTCTCTGTGGTGATGG - Intronic
1090331299 11:125934299-125934321 AATAGAACTTTCTGCAATGATGG + Intergenic
1091078748 11:132645879-132645901 AATAGACCTTTCCGCGATGACGG - Intronic
1091467087 12:694213-694235 TGTAGAACTTTCTAAGATGAGGG - Intergenic
1091804140 12:3343883-3343905 GAGAGCACTTTCAGAGATGCTGG + Intergenic
1092228019 12:6761428-6761450 AACAAAACTTTCTGTGATGATGG - Intronic
1092808061 12:12245865-12245887 TACAGAACTTTCTGTGATGATGG + Intronic
1093005337 12:14045021-14045043 AACAGAACTTTCTGCAATGATGG + Intergenic
1093449859 12:19302861-19302883 AACAGAACTTTCTGTGATGATGG - Intronic
1093635554 12:21463133-21463155 AGGAGAACTTTCTGTGATGATGG + Intronic
1093925925 12:24908299-24908321 AGTAGAACTTTCTGTGCTGATGG + Intronic
1094117455 12:26932584-26932606 AATAGAACTTACTGCGATGATGG + Intronic
1094265581 12:28555556-28555578 GATAAAAGTTTCTGAGATGATGG + Intronic
1094342327 12:29426801-29426823 AATAGAACTTTCTGCAATGATGG + Intronic
1094693420 12:32792740-32792762 AAAAGGACATTCTGAGATCAGGG + Intronic
1095539357 12:43290521-43290543 AATAGAACTTTCTGTATTGATGG + Intergenic
1095988288 12:48015477-48015499 CAAAGAACTTTCTGTGATGAAGG + Intergenic
1096673261 12:53212879-53212901 AGTAGAACTTTCTGCAATGATGG - Intronic
1097171642 12:57117898-57117920 AATAGAATTTTCTGTGATGATGG - Intronic
1097349012 12:58527249-58527271 AATAGCACTTTCTGAAGTAAGGG - Intergenic
1097381562 12:58901586-58901608 AATGGCACTTTCTGCAGTGATGG - Intronic
1097399960 12:59116823-59116845 AACAGAACTTTCTGAGATTATGG + Intergenic
1097673645 12:62572308-62572330 AACACAACTTTCTGTGATGATGG - Intronic
1097688684 12:62714102-62714124 CGTAGAACTTTCTGTGATGATGG + Intronic
1097691408 12:62737945-62737967 AATAGCACCTTTTGTGATCATGG + Intronic
1098185727 12:67894094-67894116 AATAGAACTTTCTGTGATGGTGG + Intergenic
1098653147 12:73000452-73000474 AATGGCAATTTCTGAGATTTTGG + Intergenic
1098797267 12:74906132-74906154 AATATGACTTTCTCAGAGGATGG + Intergenic
1098810870 12:75089912-75089934 AGTAGAACTTTCTGGAATGATGG - Intronic
1099098447 12:78405246-78405268 AGTAGCTCTCTCTGAGTTGAAGG + Intergenic
1099948148 12:89268718-89268740 AATAGGACATTCTGTGATGGTGG - Intergenic
1100323902 12:93523225-93523247 AAGGGAACTTTCTGAGATGATGG - Intergenic
1100740679 12:97588118-97588140 AAGGGAACTTTCTGTGATGATGG + Intergenic
1101015924 12:100500405-100500427 GATAGAACTTTCTGTGACGAAGG + Intronic
1101483403 12:105125023-105125045 AACAGAACTTTCTGTGATGATGG - Intronic
1101533348 12:105594877-105594899 AATAGGACTTACCTAGATGAAGG - Intergenic
1101648830 12:106656359-106656381 GATAGAACTTTCTGTGATGCTGG - Intronic
1101686111 12:107023440-107023462 AGTAGAACTTTCTGCAATGATGG - Intronic
1101747637 12:107555775-107555797 CATAGAAGTTTCTGTGATGATGG - Intronic
1101931397 12:109017054-109017076 AATAGAACTTTCTGCAATTATGG + Intronic
1101962033 12:109257993-109258015 ACTAGAACTTTCTGTGACGAGGG - Intronic
1101991851 12:109492366-109492388 AACAGAACTTTCTGTGATGCTGG - Intronic
1102990981 12:117315964-117315986 AGTAGAACTTCCTGTGATGATGG + Intronic
1103021546 12:117538606-117538628 AATGGAACTTTCAGTGATGATGG + Intronic
1103108001 12:118247071-118247093 GATAGAACTTTCTTTGATGATGG + Intronic
1103163474 12:118750433-118750455 TACAGGACTTTCTGTGATGATGG + Intergenic
1103421928 12:120792733-120792755 AAAAGAACTTTCTGTTATGATGG + Intronic
1103970774 12:124669921-124669943 GATGGAACTTTCTGTGATGATGG + Intergenic
1104330932 12:127844137-127844159 AATAGCAACTTCTGTGACGATGG - Intergenic
1104402842 12:128490967-128490989 AATACCAATTTTTCAGATGAGGG + Intronic
1104426231 12:128680617-128680639 CATAGAACTTTCTGTGATGATGG - Intronic
1104529626 12:129556845-129556867 AATAGAATTTTCTGTGGTGATGG - Intronic
1105491330 13:20891295-20891317 GATAGAACTTTCTGTGCTGATGG - Intronic
1106014413 13:25854689-25854711 AATAGCACTTTCTGTGAGGATGG + Intronic
1106451132 13:29883526-29883548 AACAGAACTTTCTGCAATGAAGG + Intergenic
1106526573 13:30546068-30546090 CATAGAACTTTCCGTGATGATGG - Intronic
1106986289 13:35355538-35355560 AAAAGAACTTTCTGCAATGACGG - Intronic
1107334521 13:39339882-39339904 AACAGGACTTTCTGGGATGAAGG - Intergenic
1107585028 13:41836978-41837000 AATGGCTCTTTCTAATATGATGG - Intronic
1107650244 13:42537627-42537649 AATAGCAGTTTCAGAGATGATGG + Intergenic
1107736875 13:43408053-43408075 AGTAGCACTTCCTGTGAAGAAGG + Intronic
1107812935 13:44217408-44217430 AATAGAATTTTCTGCAATGACGG + Intergenic
1108043684 13:46362687-46362709 ATTTGCTCTTTCTGAGATGCAGG - Intronic
1108187036 13:47898306-47898328 AAAAGAACTTTCTGCGATGCTGG + Intergenic
1108726412 13:53187450-53187472 AAAGGAACTTTCTGGGATGATGG + Intergenic
1109261324 13:60148489-60148511 ATTAGTGCTTTCTGAAATGATGG - Intronic
1110790737 13:79583990-79584012 AATAGGACTGACTGGGATGAGGG - Intergenic
1111215048 13:85130651-85130673 AACAGTACTTTCTGGGTTGATGG - Intergenic
1111395682 13:87666004-87666026 AATAGAATTTTCTGTGATAATGG - Intergenic
1111666129 13:91270995-91271017 AATAGAACTTTCTGTGATGATGG - Intergenic
1111882771 13:93979101-93979123 AATAGAACTTTCTGAGATGAGGG + Intronic
1111887249 13:94037838-94037860 AATAGAATTTTCTGTGATGATGG + Intronic
1112590100 13:100755131-100755153 AAAAGCACATTGGGAGATGAAGG + Intergenic
1112754348 13:102614760-102614782 AATAGAACTTTCTGTGATAATGG + Intronic
1112807276 13:103176690-103176712 ATTAGCACTTTCTTTAATGAAGG - Intergenic
1113188683 13:107718924-107718946 AAAAGAATATTCTGAGATGAAGG - Intronic
1113457893 13:110461962-110461984 AGGAGCACTTTCTGCGATGCTGG - Intronic
1113477364 13:110593997-110594019 ACTAGAACTTTCTGTGATGAAGG - Intergenic
1113659045 13:112091770-112091792 GATGGGACTTTCTGTGATGATGG - Intergenic
1114429725 14:22650392-22650414 ATTCCCATTTTCTGAGATGAGGG - Intergenic
1114438012 14:22724079-22724101 AATAGAAATTTCTGTGAGGATGG + Intergenic
1115416411 14:33139823-33139845 AGTAGAACTTTCTGTGATAATGG - Intronic
1116096057 14:40369828-40369850 AGTAGAACTTTCTGAAATGTTGG - Intergenic
1116177737 14:41494571-41494593 AATAACAAGTTCTGAAATGAAGG + Intergenic
1116186135 14:41603378-41603400 AATACAAGTTTCTGAAATGAAGG - Intergenic
1116566828 14:46457113-46457135 AAGAGAACTTTCTGAGGTAATGG - Intergenic
1117097118 14:52310238-52310260 AGTAGAACTTTCTGTGATGATGG + Intergenic
1117560890 14:56937258-56937280 AATAGAACTTTCTGCAATGACGG - Intergenic
1117658930 14:57984460-57984482 AGTAGCAATTTCTAAAATGATGG + Intergenic
1117659611 14:57989818-57989840 ATTAGCACTTTCTGTGAAGATGG + Intergenic
1117705792 14:58466346-58466368 AATAGCAATCTCTGAAATGATGG + Intronic
1118581401 14:67303152-67303174 AATAGAACTTTCTCCAATGATGG - Intronic
1118848119 14:69563438-69563460 AACAGAAATTTCTGTGATGATGG + Intergenic
1118960726 14:70528396-70528418 AAAAGGACTTTCTTAGAAGATGG - Intronic
1119010890 14:70987236-70987258 AATATAACTTTGTGTGATGATGG + Intronic
1119011451 14:70994147-70994169 AATAGGACTTCCTGGGATGATGG + Intronic
1119029980 14:71184367-71184389 AATAGAACTTTCTGTGATGGTGG + Intergenic
1119048345 14:71341076-71341098 AACAGAACTTACTGAGATGTGGG + Intronic
1119125369 14:72120821-72120843 AAGAGAACTTTCTGGGATGTTGG + Intronic
1119753379 14:77097215-77097237 AATATAACTTTCTGCGATGCTGG + Intergenic
1120388096 14:83870783-83870805 GATAGGACTTTCTGAGGTGTTGG + Intergenic
1120896244 14:89534923-89534945 AAGAGCAGATTCTGAGATGTGGG - Intronic
1121457429 14:94047371-94047393 AATAGCACTCTCAGATATCAGGG + Exonic
1121744103 14:96274531-96274553 AATTGGACTTTATGAAATGAAGG + Intergenic
1121753235 14:96377251-96377273 AATGGAACTTTCTGTGATGACGG - Intronic
1121853265 14:97243321-97243343 CATGGCACTTTCTGTGATGAAGG + Intergenic
1123187755 14:106536728-106536750 AATCGCACTCTTTGAGATGCTGG + Intergenic
1124090229 15:26592542-26592564 AAAAGAACATTCTGAAATGAAGG + Intronic
1124114192 15:26825091-26825113 AATAGTACTTACTGCAATGAAGG + Intronic
1124861635 15:33447769-33447791 AAAAGAACTTTCAGTGATGATGG - Intronic
1125302372 15:38269706-38269728 AATAGAACATTCTGTGATGATGG + Intronic
1125921138 15:43526649-43526671 GAAAGCACTTTCCTAGATGAGGG + Exonic
1126358881 15:47824881-47824903 AAGGCCACTTTCTGGGATGATGG - Intergenic
1126711391 15:51461013-51461035 CATAGAACTTTCTGTGATGATGG - Intronic
1126941790 15:53775351-53775373 TATAGCACACTCTGACATGAAGG + Intergenic
1127616000 15:60686307-60686329 AATAGTAATCTCTGAGAAGAGGG - Intronic
1127856357 15:62956908-62956930 AATAGAACTCTCTGTGATGATGG + Intergenic
1128714600 15:69898807-69898829 AGTAGAACTTTCTGTGGTGAAGG - Intergenic
1128782506 15:70371246-70371268 AATAGCACGTTCTGAAATTGAGG + Intergenic
1128893019 15:71347784-71347806 AAGAGAACTTTCTGTGATGATGG - Intronic
1129482261 15:75836805-75836827 AATAGAACTTTCTGCAATGATGG - Intergenic
1130102068 15:80901812-80901834 ACTAGAACTTCCTGTGATGAAGG - Intronic
1130369697 15:83274508-83274530 AGTAGAGCTTTCTGTGATGATGG - Intronic
1131550822 15:93355377-93355399 AACAGCACTCTCTGGGATGATGG + Intergenic
1132228868 15:100166981-100167003 AATAAAACTTTCTGCGATGACGG + Intronic
1133647069 16:7774541-7774563 AGTAGAACCTTCTGTGATGATGG - Intergenic
1133657893 16:7884229-7884251 AATAGAACTTTCTGTGATGATGG + Intergenic
1133832070 16:9332530-9332552 AAGAGCGCTTTCTGAAATGACGG - Intergenic
1133883212 16:9802723-9802745 AATAGAACTTTCTGCAATGCTGG + Intronic
1134300001 16:12982373-12982395 AACAGAACCTTCTGAGATGATGG - Intronic
1134378629 16:13703126-13703148 AATAGAACTTTCTAAGATGAAGG + Intergenic
1135090940 16:19516532-19516554 AGTAGAACTTTCTGCAATGATGG - Intronic
1135272528 16:21081779-21081801 AGTAGAACCTTCTGTGATGATGG + Intronic
1135635893 16:24075254-24075276 AATAGAACTTTCTAAAATAATGG - Intronic
1136860607 16:33699422-33699444 CATAGAACTTTCTGTGATCATGG - Intergenic
1137428842 16:48402054-48402076 AGTAGAACCTTCTGGGATGATGG - Intronic
1137490388 16:48927539-48927561 AATAGAACTTTCTGTGATGATGG + Intergenic
1137534505 16:49308047-49308069 AATAGAACTTTCAGTGATGAAGG + Intergenic
1138168532 16:54826695-54826717 AAAAGAACTTTCTGGGGTGACGG - Intergenic
1138342960 16:56302690-56302712 CAAAGCACCTTCTGAGAAGAGGG - Intronic
1138440606 16:57032687-57032709 AATAGAACTTTCTGCAATGATGG - Intronic
1138616503 16:58171664-58171686 AATAGGACCTTCTGCAATGATGG + Intronic
1139262838 16:65611517-65611539 AATAGAACTTTCTGCAATGATGG - Intergenic
1139556100 16:67711708-67711730 GTTACCAGTTTCTGAGATGAAGG - Intronic
1140055793 16:71524557-71524579 AATAACAGTCTCTGTGATGATGG - Intronic
1140181200 16:72720276-72720298 AATAGCACTTTCTGCGATGATGG + Intergenic
1140203234 16:72911782-72911804 ACTAGAACTTTCTGTGATGATGG - Intronic
1140445323 16:75022732-75022754 AACAGCACTTTCTGCAATGATGG - Intronic
1140724922 16:77803327-77803349 AATAGAACTTTCTGGAATGATGG - Intronic
1140860277 16:79012127-79012149 AATAGAACTTTCTGCAGTGATGG + Intronic
1141105497 16:81230024-81230046 AATAGAACTTTCTGTGATCATGG + Intergenic
1143566966 17:7728092-7728114 AATAGCACTCTCTGGGATAGCGG - Intronic
1144051486 17:11500788-11500810 AATAGCACTTTCTGAGATGATGG - Intronic
1144062658 17:11597985-11598007 AGTAGAACTTTCTGCGATGATGG - Intergenic
1144119468 17:12136466-12136488 AATAAAACTTTTTGAGATGCTGG + Intronic
1144376647 17:14649554-14649576 AAGAGAACTTTCTGGAATGATGG - Intergenic
1144442206 17:15293697-15293719 AATAGGGCTTTCTGCAATGATGG - Intergenic
1145919166 17:28597525-28597547 AATAGAACTTTCTGGGATGAGGG - Intronic
1146665164 17:34696400-34696422 AATAGTACTTTTAGAAATGAAGG + Intergenic
1146835454 17:36107164-36107186 AACAGAACTTTCTGCAATGATGG - Intergenic
1146850077 17:36214433-36214455 AACAGAACTTTCTGCAATGATGG - Intronic
1146970066 17:37065350-37065372 GATAGAACTTTCTAGGATGATGG + Intergenic
1147015368 17:37487989-37488011 AGTAGAACTTTGTGTGATGATGG - Intergenic
1147956572 17:44138749-44138771 GATAGAACTTTCTGTGTTGATGG - Intergenic
1148136412 17:45294934-45294956 AATAGAACTTTCTGCAATGCTGG - Intronic
1148148019 17:45378247-45378269 AGTACCATTTTCTGAAATGATGG + Intergenic
1148945240 17:51256774-51256796 AATAGAAGTTTCTGCAATGATGG - Intronic
1149072618 17:52560705-52560727 AATAGAACTTTGAGTGATGATGG - Intergenic
1149346752 17:55745813-55745835 AATAGAAGTTTCTGAGTTAATGG - Intergenic
1149359909 17:55884152-55884174 AAAAGCAGTTTAAGAGATGAAGG - Intergenic
1149529278 17:57381599-57381621 TATAGAACTTTCTGTGATGGAGG + Intronic
1150352242 17:64454515-64454537 AGTAGAACTTTCTGTGATGATGG - Intronic
1150749415 17:67846415-67846437 AATAGAACTTTTTGTGATGATGG + Intronic
1150846631 17:68665521-68665543 AAGGTCACATTCTGAGATGATGG - Intergenic
1151376012 17:73689603-73689625 AATAAGACTTTCTGAGATGTTGG + Intergenic
1151381560 17:73729339-73729361 AATAGAATTTTCTGTGATAAGGG - Intergenic
1151609045 17:75159160-75159182 AATTGCAGTTTCTGGGGTGAGGG + Intronic
1151912270 17:77091477-77091499 AGCAGCACTTTCTGCAATGATGG + Intronic
1151943819 17:77308437-77308459 AATAGAACCTTCTGTGATGGTGG + Intronic
1153031373 18:716358-716380 AATGGAATTTTCTGAAATGATGG + Intergenic
1153060631 18:991276-991298 AATGGCACATTCTGAGGTGCTGG + Intergenic
1153177636 18:2396295-2396317 CATAGCACTTTCAGAGGTGGAGG + Intergenic
1153329902 18:3863046-3863068 AATACAACTTTCTGTGATGACGG + Intronic
1153370803 18:4313693-4313715 AAGAGAACCTTCTGAAATGATGG + Intronic
1153520001 18:5942696-5942718 AACAGAACTTTCTGTGGTGATGG + Intergenic
1153687787 18:7564131-7564153 AATAGTGCTTTCTATGATGATGG + Intergenic
1153706196 18:7748150-7748172 AGGAGAACTTTCTGTGATGATGG + Intronic
1153737367 18:8085075-8085097 AATAGAACTTTCTGAAATGATGG - Intronic
1153758643 18:8308914-8308936 AGTAGAACTTTCTGTGCTGATGG - Intronic
1153873285 18:9340736-9340758 GATAGAGCTTTCTGCGATGATGG + Intronic
1154000718 18:10480099-10480121 AATAGCCCTTTCTAAGATTCGGG + Intronic
1154234916 18:12595829-12595851 AATAGCAGCTTCTGAAATGCTGG - Intronic
1154992191 18:21607819-21607841 AATCACACTTTCTATGATGATGG + Intergenic
1155133704 18:22965836-22965858 AATAGCATTTTCTGTGATCGTGG + Intronic
1155165787 18:23231393-23231415 AACAGAACTTCCTGTGATGACGG - Intronic
1155194963 18:23465537-23465559 AATAGAACTTTCTGTGGTAATGG + Intronic
1155287760 18:24308645-24308667 AATAGAACTTTCTATGATGCTGG + Intronic
1156286199 18:35698625-35698647 AGTAGAACTTTCTGAGATGATGG - Intronic
1156407423 18:36796274-36796296 AACAGAACTTTCTGTGGTGATGG + Intronic
1156685694 18:39642634-39642656 AATAGAACTTTCTAAGATTATGG + Intergenic
1157989684 18:52479596-52479618 AATAGAACTTAGTGAGAGGAAGG - Intronic
1158285458 18:55876017-55876039 AAAAGAACTTTCTGTAATGATGG + Intergenic
1158592507 18:58789664-58789686 CAGAGCACTTTCGGAAATGAGGG - Intergenic
1158884400 18:61812316-61812338 AATAGGGCTTTCTGTGATGATGG - Exonic
1159593459 18:70359792-70359814 AATAGGACTCTCTGTGATGATGG + Intergenic
1160042430 18:75358068-75358090 AGTAGCACTTTCTGCAACGAGGG - Intergenic
1161445838 19:4318672-4318694 AATAGGAGTTTCCCAGATGACGG + Intronic
1161708804 19:5835480-5835502 CACAGAACTTTCTGTGATGATGG + Intronic
1162846456 19:13396464-13396486 CCTAGAACTTTCTGGGATGATGG + Intronic
1163111600 19:15164685-15164707 AATAGGACTTTCTGTGATGATGG - Intronic
1163155178 19:15436270-15436292 TATAGAACTTTCTGAGATGATGG - Intronic
1163985207 19:20940112-20940134 AAAAACACTTTGTGATATGAAGG + Intronic
1164549373 19:29195821-29195843 AATAGAACTGTCTGTAATGAAGG - Intergenic
1166018477 19:40002587-40002609 AATAGAACTTTCCATGATGATGG + Intronic
1166632930 19:44423533-44423555 AATAACAATTTCTGAAATTAAGG - Intronic
1166928553 19:46286713-46286735 AACAGAACTTTCTATGATGATGG - Intergenic
1167225066 19:48232749-48232771 AAGAGAACTTTCTGTGATGACGG - Intronic
1167268462 19:48494707-48494729 AACTGCCCTTTCTGAGCTGATGG + Intronic
1167297932 19:48662760-48662782 AAATGCACTTTCTGAGAGGCTGG + Intronic
1167468207 19:49661301-49661323 AGTGGCACTTTCTGCCATGATGG - Intronic
1167688568 19:50971255-50971277 GATAGCACGTCCTGAGAAGAAGG - Intergenic
1168170243 19:54582440-54582462 AATAACAGGTTCTGAAATGAAGG - Intronic
1168356533 19:55703668-55703690 GATGGAACTTTCTGAGATGCCGG + Intronic
1168656952 19:58136847-58136869 AATAACACATTCTGGGATGTGGG + Intronic
1202708245 1_KI270713v1_random:40522-40544 AACAGGCCTTTCTCAGATGATGG + Intergenic
925481400 2:4278316-4278338 AGTAGAACTTTCTGGGGTGAGGG + Intergenic
925811039 2:7701039-7701061 AATAGAACTTTCTATGATAATGG - Intergenic
925939934 2:8807404-8807426 AGTAGAACTTTCTGTGTTGATGG + Intronic
926283524 2:11469284-11469306 ACTAGGGCTTTCTGTGATGATGG + Intergenic
926458864 2:13102556-13102578 AATACAACATTCTGAGATAAGGG - Intergenic
926661300 2:15470029-15470051 AATAGCTCTTTCTAGGAAGAGGG - Intronic
926949224 2:18223564-18223586 AATAGAACTCTCTGTGATGATGG - Intronic
927067314 2:19486412-19486434 AACAGCACTTTCTGTGATGACGG + Intergenic
927095511 2:19745142-19745164 AGTAGAACTTTCTGGGATGACGG - Intergenic
927220675 2:20705922-20705944 AATATAACTTTCTGTGATGGTGG + Intronic
927533404 2:23832612-23832634 AATAGAATTTTCTGTGATGATGG - Intronic
927543707 2:23934394-23934416 AGTAGAACTTTCTGTGATGATGG - Intronic
927699075 2:25256617-25256639 AAAAGAACTTTCTGGGATGATGG - Intronic
928376944 2:30783017-30783039 AATAGAACATTCTGTGATGATGG - Intronic
928636005 2:33247665-33247687 AATAGAACTATCTGAGATGATGG + Intronic
928933912 2:36654749-36654771 AATAGAGCTTTCTGGGATAATGG - Intergenic
929073624 2:38059084-38059106 AATAGAACTTTCCGCTATGATGG + Intronic
929163484 2:38857060-38857082 AATAGAACTTTCCGTGTTGATGG + Intronic
929677104 2:43946846-43946868 AAAAGCTCTTTCTGAGATAAAGG - Intronic
929716645 2:44317551-44317573 AATAGAACTTTCTGTAATGCTGG - Intronic
930257584 2:49109727-49109749 AAAAGCAATTTCTGAGATACTGG - Intronic
930270045 2:49245641-49245663 AATAGCAGGTTCTGAAATCAAGG + Intergenic
930365161 2:50430378-50430400 AATAGAACTTTCTGTGATGATGG + Intronic
930405028 2:50943505-50943527 AATAGCACCTTCTATAATGATGG + Intronic
931701949 2:64916587-64916609 AGTAGAACTTTCTGTGATGGTGG - Intergenic
931722169 2:65075020-65075042 AATAGGACTTTATGTGGTGATGG - Intronic
932121817 2:69108023-69108045 AATAGAACTTTCTGTAATGATGG + Intronic
932259166 2:70312528-70312550 AATAGAACTTTCTGCAATTATGG - Intergenic
932402018 2:71487147-71487169 ACTAGAACTTTCTGAGATGATGG + Intronic
932830309 2:74983032-74983054 AATAGAATTTTCTGTGATGATGG + Intergenic
933449439 2:82428390-82428412 AATAGAACTTTGTGTGATGATGG - Intergenic
933986236 2:87594553-87594575 AAGAGGACTTTCTGAAAAGAAGG - Intergenic
934039148 2:88113434-88113456 AATGGAATTTTCTGTGATGATGG + Intergenic
934105304 2:88690109-88690131 AACAGAACATTCTGAGAAGACGG - Intergenic
934145548 2:89089780-89089802 GATGGCACTTTATGAGAAGATGG - Intergenic
934223707 2:90110792-90110814 GATGGCACTTTATGAGAAGATGG + Intergenic
934582988 2:95461490-95461512 AATAACATTTTCTGATTTGAAGG + Intergenic
934596462 2:95615224-95615246 AATAACATTTTCTGATTTGAAGG - Intergenic
934602069 2:95665307-95665329 AAGAGAACTTTCTGGGATGGTGG - Intergenic
934736003 2:96690070-96690092 AGTAGAACTTTCTGTGATGATGG + Intergenic
934786305 2:97010330-97010352 AATAACATTTTCTGATTTGAAGG + Intronic
934868737 2:97839857-97839879 AGCAGAACTTTCTGTGATGATGG - Intronic
934879518 2:97963038-97963060 AGGGGAACTTTCTGAGATGATGG + Intronic
934885701 2:98022334-98022356 AATAGAACTTTCTGTGATCATGG - Intergenic
935212206 2:100947670-100947692 AATAGAACTGTCTGTGATGATGG - Intronic
935296895 2:101657560-101657582 AATAGAACTTTCCAAGAGGATGG - Intergenic
935352891 2:102169497-102169519 AATAGAACTTTCAGTGATGTTGG - Intronic
935554624 2:104495403-104495425 AATAGAACTTTGTGTAATGATGG + Intergenic
935963181 2:108447494-108447516 AATTTTATTTTCTGAGATGATGG - Intergenic
936307599 2:111356250-111356272 AAGAGGACTTTCTGAAAAGAAGG + Intergenic
936535423 2:113307462-113307484 AAGAGAACTTTCTGGGATGGTGG - Intergenic
936562027 2:113548023-113548045 AATAGAAGTTTCTTTGATGATGG + Intergenic
936867403 2:117090561-117090583 CATAGAAGTTTCTGAGATGATGG - Intergenic
937070310 2:119058069-119058091 AATAGAGTTTTCTGTGATGATGG + Intergenic
937797536 2:126041603-126041625 AAGAGCAGTTTTTGAGAAGATGG + Intergenic
937893631 2:126960285-126960307 AATAACAAGTTCTGAGATTAAGG - Intergenic
938048525 2:128145416-128145438 AACAGAACTTTCTGCAATGATGG - Intronic
938838997 2:135139682-135139704 AATAAAACTTTCTGTGAAGATGG + Intronic
939166471 2:138646291-138646313 AATAGTAATTCCTGGGATGAAGG + Intergenic
939310983 2:140475948-140475970 AGTAGAACTTTCTGTGATAATGG - Intronic
939357381 2:141121330-141121352 TATACTCCTTTCTGAGATGAAGG - Intronic
939739111 2:145884420-145884442 AATAGAAATTTCTATGATGATGG - Intergenic
939760225 2:146166934-146166956 AATAACACTATGTGAGGTGATGG + Intergenic
940046910 2:149419566-149419588 AATAAGACTTTCTGTAATGACGG - Intronic
940249648 2:151660821-151660843 AATAGAACTTTCTGTAATGATGG + Intronic
940351261 2:152691574-152691596 AATAGAACTTTCTGCAGTGATGG - Intronic
940586079 2:155652431-155652453 AATAGAAAACTCTGAGATGAGGG - Intergenic
940671659 2:156676987-156677009 AATTGAGCTTTCTGAGATGAAGG + Intergenic
940794444 2:158062163-158062185 AATAGAACTTTCTATGATGACGG + Intronic
941080537 2:161055719-161055741 ATTAGAACTTTCTGAGATGATGG + Intergenic
941945362 2:171090989-171091011 AATAGAAGTTTCTGATATGATGG - Intronic
941995551 2:171598674-171598696 AATAGAACTTTTTGTGATGATGG + Intergenic
942010506 2:171757882-171757904 AATAACAAGTTCTGAAATGAAGG - Intergenic
942533775 2:176941320-176941342 AATAGAACATTCTGTGACGATGG + Intergenic
942565518 2:177262290-177262312 TAAAGCACTTTCCTAGATGAGGG - Intronic
942578286 2:177389651-177389673 AAGAGCACTTTCCAAGATGATGG - Intronic
943512896 2:188848198-188848220 AAAAGGAATTTCTGAGATGCTGG + Intergenic
943601638 2:189927906-189927928 AATACAACTTTCTGCAATGATGG - Intronic
943903186 2:193467527-193467549 AAGACAACTTTCTGTGATGATGG + Intergenic
943917360 2:193652755-193652777 GATAAACCTTTCTGAGATGATGG - Intergenic
944036769 2:195303706-195303728 AAGGGCACATTCTGAGATGATGG + Intergenic
944054093 2:195504759-195504781 ATTAGAACTTCCTGTGATGATGG + Intergenic
944071826 2:195678982-195679004 AATAGAACTTTCTATAATGATGG + Intronic
944448854 2:199820571-199820593 AATAGAACTTTCTGTGGCGATGG - Intronic
944527911 2:200639181-200639203 AATAAAACTTTCTGTGATGATGG - Intronic
944846173 2:203670377-203670399 AGTAGAACTTTCTGTGCTGATGG + Intergenic
944888126 2:204086011-204086033 GATAGAACTTTCTGCAATGATGG - Intergenic
944920075 2:204403605-204403627 AATAGAACTTTCTGCAATGATGG + Intergenic
945008036 2:205430562-205430584 AATAGGATTTTCCGTGATGATGG - Intronic
945194560 2:207226129-207226151 CATAGAACTTTCTGGAATGATGG + Intergenic
945256655 2:207808892-207808914 AGTAGAACATTCTGGGATGATGG - Intergenic
945464530 2:210152427-210152449 AATAGAAACTTCTGAGATGTTGG - Intronic
945611609 2:212011398-212011420 AATAGAACTTTCTGTGATAATGG - Intronic
946168107 2:217877710-217877732 CAGAGCAGTTCCTGAGATGATGG + Intronic
946243306 2:218370199-218370221 AATAGAACTTTCTGCAGTGATGG + Intergenic
946342249 2:219077841-219077863 AATCGAACTTTCTGCAATGATGG + Intronic
946398423 2:219455341-219455363 AATAGACATTTCTGTGATGATGG + Intronic
946411889 2:219519554-219519576 AATAGAACATTCTGTGGTGATGG + Intronic
946584677 2:221171771-221171793 AATAGCACTTAGTGTGAAGATGG - Intergenic
947394136 2:229670706-229670728 AACAGTACCTTCTGTGATGATGG + Intronic
947549513 2:231036769-231036791 AATAGAACATTCTGTGATGATGG - Intergenic
948227511 2:236322934-236322956 AGTAGAACTTTCTGCAATGATGG - Intergenic
948298304 2:236881374-236881396 AATAGAACTTTTTGTGATGATGG + Intergenic
1169359111 20:4933035-4933057 AATAGAACTTTCTGCAATGAGGG + Intronic
1169579025 20:6998010-6998032 AACAGAACTTTCTGTGATGGTGG - Intergenic
1169682331 20:8229621-8229643 AATAAAACTTTCTGCGATGATGG - Intronic
1169702327 20:8460932-8460954 AATAGAACTTTCTGTGATGATGG + Intronic
1169736714 20:8845573-8845595 AATAGAACTTTCTGTAATGATGG - Intronic
1169850564 20:10045299-10045321 AATAGAACTTTTGGTGATGATGG + Intronic
1170132056 20:13031178-13031200 AATAGAACTTCCTATGATGATGG + Intronic
1170236376 20:14109724-14109746 AATAACACATTATGAGATCAAGG + Intronic
1170243049 20:14191645-14191667 AAAAGGACTTCCTGAGAAGATGG + Intronic
1170296606 20:14832982-14833004 AATAGAACTTTCTGTAATGATGG + Intronic
1170765140 20:19283505-19283527 AATAGCTCTTTCTGTGATGATGG - Intronic
1170772761 20:19348445-19348467 AACAGAACTTTCTGTGATGATGG - Intronic
1170937429 20:20822329-20822351 GATAGAACTTTCTATGATGATGG + Intergenic
1171186307 20:23126570-23126592 AGTAGTACTTTTTGTGATGATGG - Intergenic
1171359846 20:24579538-24579560 AATAGGACCTTCTGAGGTGGTGG + Intronic
1171416993 20:24988859-24988881 AATAGAACTTTCTGCAACGATGG + Intronic
1171724707 20:28605455-28605477 AATAGCACATTATAAGTTGAGGG + Intergenic
1171753358 20:29077593-29077615 AATAGCACATTGTAAGTTGAGGG - Intergenic
1171788897 20:29499967-29499989 AATAGCACATTGTAAGTTGAGGG + Intergenic
1171858633 20:30374532-30374554 AATAGCACATTGTAAGTTGAGGG - Intergenic
1171949026 20:31404556-31404578 AATAGAACATTCTGCCATGATGG - Intergenic
1172294132 20:33796469-33796491 AACAGCACTTTGAGAGAAGAAGG + Intergenic
1172641718 20:36444206-36444228 AGTAGAACTTTCTGTAATGATGG + Intronic
1172708590 20:36902186-36902208 AGTAGTATTTTTTGAGATGAGGG + Intronic
1172713221 20:36943267-36943289 AGTAGAACTTTCTGCGATGATGG + Intronic
1172973783 20:38891867-38891889 AATAGAACTTTCTACAATGATGG + Intronic
1173064092 20:39692935-39692957 AATAGAACATTCTGCAATGATGG - Intergenic
1173360501 20:42340060-42340082 AATAGAATTTTCTGTCATGATGG + Intronic
1173766322 20:45613289-45613311 AGTAGAACTTTCTGTGATGATGG - Intronic
1173905940 20:46628832-46628854 TATAAAACTTTCTGTGATGATGG - Intronic
1173980595 20:47221055-47221077 AGGAGAACTTTCTGCGATGATGG - Intronic
1174035252 20:47664805-47664827 AATAGAACATTCTGTGCTGACGG - Intronic
1174567622 20:51477999-51478021 AATAGGACTTTCTGTGATGATGG - Intronic
1174623784 20:51897506-51897528 AATAGAACTTTCTGCAATGATGG + Intergenic
1174671318 20:52310508-52310530 AGTAGAATTTTCTGTGATGATGG - Intergenic
1174756544 20:53164508-53164530 AATAGAACTTTCTGTGATGATGG + Intronic
1175038497 20:56022931-56022953 AGCAGAACTTTCTGGGATGATGG + Intergenic
1175167122 20:57052330-57052352 AATAGAAGTTTCTGTGATGATGG - Intergenic
1175535685 20:59709610-59709632 AATTGCCCTTCCTAAGATGAAGG - Intronic
1175543427 20:59762523-59762545 AGTAGCACTTTCTGAGATGATGG - Intronic
1176975995 21:15322718-15322740 AATTTGACTTTCTGAGGTGAAGG - Intergenic
1177014627 21:15770771-15770793 ATTAGAACTTTCTGTGATAATGG - Intronic
1177021867 21:15871054-15871076 AATAGAAATTTCTGTGATTATGG - Intronic
1177084685 21:16688788-16688810 AATAGAACTTTCTGTGATGATGG + Intergenic
1177186661 21:17805046-17805068 AACAGAACTTTCTGTGATGATGG + Intronic
1178010648 21:28282120-28282142 AATAGCATTATCTGTGATGCTGG + Intergenic
1178050305 21:28739626-28739648 AACAGAACTTTCTGTGATGATGG + Intergenic
1178757472 21:35365248-35365270 TATAGCAGCTTCTGATATGAAGG - Intronic
1179067061 21:38034947-38034969 AATAGAACTTTCTGAAATTATGG - Intronic
1179193239 21:39141155-39141177 AATAGAACTTTCTGAAATCCTGG + Intergenic
1179238371 21:39567043-39567065 AATAGAACTATCTGTGATGATGG - Intronic
1180298257 22:10964145-10964167 AATAGCACATTGTAAGTTGAGGG + Intergenic
1180410154 22:12599655-12599677 AATAGCACATTGTAAGTTGAGGG - Intergenic
1181744993 22:24950146-24950168 AATAGAACTTTCTGCAACGATGG - Intergenic
1181885928 22:26022512-26022534 AAAAGCACTTGCAGAGATGTAGG + Intronic
1182013383 22:27019128-27019150 AATAGAACTTTCTGTGATGACGG - Intergenic
1182118063 22:27768929-27768951 CATAGAACTTTCTGGAATGATGG - Intronic
1182407516 22:30149455-30149477 ATTAGAACTTTCTGTGATGATGG - Intronic
1182463331 22:30497822-30497844 AAGAGAACGTTCTGTGATGATGG + Intronic
1182975515 22:34620758-34620780 GAAAGGACTTTCTGTGATGATGG + Intergenic
1183488157 22:38100983-38101005 AAGAGAACTTTCTGGGTTGATGG + Intronic
1183507087 22:38215199-38215221 AAGAGCAGTTTCCAAGATGAGGG - Exonic
1183771476 22:39929869-39929891 GGTAGCATTTTCTGAGATAAGGG - Intronic
1183777411 22:39975559-39975581 AATAGCACGTACACAGATGATGG + Intergenic
1183777603 22:39977134-39977156 ATTAGGACTTTCTGTGATGAGGG + Intergenic
1183993259 22:41613210-41613232 AATAGAACTTTCTGCAGTGATGG - Intronic
1184636856 22:45839493-45839515 AAAAGCCCTCTCGGAGATGAAGG - Intronic
949130517 3:494847-494869 AATAGAACATTCTGAGTTGATGG - Intergenic
949259526 3:2089201-2089223 AATAGCACTTGCGGATGTGAGGG - Intergenic
949348212 3:3097135-3097157 AATAGAACTATCTGGGATGAGGG + Intronic
949358452 3:3206358-3206380 AATAGAACTTTCTGTGGTGATGG - Intergenic
949683083 3:6538157-6538179 AATAGCAAGTTCTGAAATGGAGG - Intergenic
949690751 3:6635467-6635489 AATAGAACTTTCTGTGATGTTGG - Intergenic
949902710 3:8831951-8831973 AATATAACTTTCTGTGATGATGG - Intronic
950011025 3:9723923-9723945 AATAGCACTTTCTGCAATGATGG + Intronic
950023867 3:9807649-9807671 AATGGAACTTTCTGCAATGATGG - Intronic
950888806 3:16384877-16384899 AATAGAACGTTCTATGATGATGG - Intronic
951130831 3:19042265-19042287 AATAGAACCTTCTGAGATGATGG - Intergenic
951230079 3:20168526-20168548 AACTGTACTTTCTGTGATGATGG + Intronic
951356508 3:21673357-21673379 AATAGCACCTTCTGTGAGAATGG - Intronic
951534925 3:23731815-23731837 AATAGAACTTTCTGCAATGGTGG + Intergenic
951691915 3:25405759-25405781 AATAAAACTTTCTGTGATGACGG - Intronic
951693551 3:25421956-25421978 AATAGAGCTTTCTGCAATGATGG + Intronic
952106437 3:30075401-30075423 AATACCTGTATCTGAGATGACGG + Intergenic
952206842 3:31188723-31188745 AATAGCACTTTCCTAGATAACGG - Intergenic
952274613 3:31865227-31865249 AACAGAACTTTCTGTGATAATGG + Intronic
952338747 3:32427666-32427688 AATAGAACTTTCTGTGATGATGG - Intronic
952740612 3:36730726-36730748 AGTAGAATTTTCTGTGATGATGG - Intronic
952822350 3:37496112-37496134 AACAGCAGTTTCTGAAAGGAAGG - Intronic
952829838 3:37555316-37555338 AGCAGAACTTTCTGTGATGAAGG + Intronic
953143968 3:40255995-40256017 AATAGAACTTTGTGTAATGAGGG + Intronic
953242207 3:41159645-41159667 AATAGAACTGTCTGTGATGATGG - Intergenic
953415779 3:42715730-42715752 AGTGGAACTTTCTGTGATGATGG - Intronic
953449557 3:42994891-42994913 AACAGAACTTTCTGAGATGATGG + Intronic
953601091 3:44365687-44365709 AAGAGAACTTTCTGTGATGAGGG + Intronic
953687786 3:45091646-45091668 AACCGAACTTTCTGCGATGATGG + Intronic
954081850 3:48216906-48216928 AATAGAACTTTCTGTGATCAAGG + Intergenic
954952491 3:54487908-54487930 AACAGCACTTTGTATGATGATGG - Intronic
954961089 3:54565517-54565539 AAAAGGACTTTATGAGATGGTGG + Intronic
955112749 3:55965236-55965258 AATAGAACTTTCTGCAATTATGG + Intronic
955137666 3:56235855-56235877 AGCAGAACTTTCTGTGATGATGG - Intronic
955178716 3:56644826-56644848 AATAGAACTTTCTGCAATAATGG + Intronic
955474724 3:59324836-59324858 GATGGAACTTTCTGGGATGATGG + Intergenic
955496819 3:59542214-59542236 GATAGAACTTTCTGGAATGATGG - Intergenic
955533279 3:59897162-59897184 AAAAGAACTTTCTGCAATGATGG + Intronic
955628507 3:60946837-60946859 AAAAGAACTTTCTGTGATGATGG + Intronic
956015387 3:64876852-64876874 ACCAGAACTTTCTGTGATGATGG - Intergenic
956016634 3:64890641-64890663 AACAGAACTTTCTGCAATGACGG - Intergenic
956024806 3:64971748-64971770 AGCAGAGCTTTCTGAGATGATGG + Intergenic
956058449 3:65325459-65325481 AATAGAACTTTCTGCAGTGATGG - Intergenic
956069612 3:65433857-65433879 AATGGCACTTTCCGTGATGATGG + Intronic
956127121 3:66021269-66021291 AATAGAACTTTCTGTGATGATGG - Intronic
956203710 3:66734193-66734215 AATAGGACTTTCTGTGATGATGG - Intergenic
956384478 3:68702224-68702246 AATAGGTCTTTCTGTAATGATGG + Intergenic
956544446 3:70384834-70384856 AATAGAGCTTTCTAGGATGATGG + Intergenic
956682914 3:71798002-71798024 AATAGAACTTTCTGCAATGGTGG + Intergenic
956771531 3:72530256-72530278 AATAGAACTTTTTGCAATGATGG - Intergenic
956906202 3:73767918-73767940 AATAGGACTTTCTGCAATAATGG + Intergenic
957015580 3:75060708-75060730 AATAGGACTTTCTCTGATGATGG - Intergenic
957404391 3:79758196-79758218 AATAGAACTTTCTCTGATGATGG + Intronic
957456143 3:80449528-80449550 AATAGCATTTTGTGACATCAGGG + Intergenic
957502021 3:81069495-81069517 AATATCACTTTCTGACAGGCCGG + Intergenic
957836375 3:85596677-85596699 AATAGAACTTTTTGAGATGATGG - Intronic
958271400 3:91503910-91503932 AATAGAACTTTCTGTGATGATGG - Intergenic
958428027 3:94002172-94002194 AGTAGAACTTTCTGCAATGATGG + Intronic
958879196 3:99650334-99650356 AATAGAACTTTCTGCAATGATGG + Intronic
959081614 3:101807840-101807862 AACACAACTTTTTGAGATGATGG - Intronic
959121462 3:102237554-102237576 AATAGAACTTTCTGTGATAATGG + Intronic
959808230 3:110584611-110584633 AATAGAACGTTCTGTGATGGTGG - Intergenic
960135664 3:114102326-114102348 AACAGAACTTTCTGTGATGAAGG + Intergenic
960518464 3:118628236-118628258 AATAATACTTTCTGTAATGATGG + Intergenic
960569936 3:119175728-119175750 AGTAAAACTTTCTGTGATGAGGG + Intronic
960884306 3:122378977-122378999 AGTAGGACTTTCTGTGATGGTGG - Intronic
961097216 3:124167910-124167932 AGTAGAACTTCCTGTGATGATGG - Intronic
961161782 3:124732679-124732701 GATAGAACTTTCTGCAATGATGG - Intronic
961391490 3:126554911-126554933 AGTAGAACTTTCTGAGATGATGG + Intronic
961738836 3:129019625-129019647 AACTGGACTTTATGAGATGATGG + Intronic
961902607 3:130227777-130227799 AACAGAACATTCTGAGATCATGG + Intergenic
962036814 3:131660569-131660591 AATAAAACTTTCCGTGATGATGG - Intronic
962136485 3:132739841-132739863 AATAGAAGTTTCTCTGATGAAGG - Intergenic
962142004 3:132800208-132800230 AGTTGAACTTTCTGTGATGATGG - Intergenic
962459733 3:135599080-135599102 AATAAAACTTTCTGTGATGATGG + Intergenic
962490381 3:135887919-135887941 AGAAGAACTTTCTGTGATGATGG - Intergenic
962491210 3:135895869-135895891 AATAGAACTTTCTATGATGATGG + Intergenic
962824755 3:139090200-139090222 AATAGAACTTTCTGAGATGATGG + Intronic
963020746 3:140870713-140870735 AATAGAACTTTCTGCAATTATGG + Intergenic
963321048 3:143809743-143809765 AATAGAACTTTTTGTGATGGTGG + Intronic
963619480 3:147587676-147587698 AATAGCACTCTATGAGATACAGG + Intergenic
964091391 3:152880081-152880103 AATAGAACTTTCTGTGAGAATGG + Intergenic
964772396 3:160238231-160238253 AATAGCACATTCTTAAATTAAGG + Intronic
965316008 3:167191344-167191366 AATATCAATTCCTGAGATGGTGG - Intergenic
965481240 3:169222127-169222149 CATAGAACTTTCTGTGACGATGG - Intronic
965523981 3:169697454-169697476 AAAAGCAGATTCTGAGATAAAGG - Intergenic
965785638 3:172331847-172331869 AATAGAACTTTCTGCAGTGATGG + Intronic
966413882 3:179669608-179669630 AAAAGAACTTTCTGAGATGATGG + Intronic
966603502 3:181798955-181798977 AGTAGAACTTTCTGTGATAATGG + Intergenic
966845516 3:184126442-184126464 AATAGAACTTTCTGAAATAGTGG + Intergenic
966951795 3:184826495-184826517 AAGAGAACTTTCTGTGATGACGG - Intronic
967451398 3:189627633-189627655 AATAGAACTTTCTGTTATAAAGG - Intergenic
967881772 3:194306508-194306530 AATACCACCTTCTGAGAAGGGGG + Intergenic
968211608 3:196853616-196853638 AATAGAACTTTCTGCAATGATGG + Intergenic
969931989 4:10639783-10639805 AACAGACCTTTCTGTGATGATGG - Intronic
970575482 4:17422870-17422892 AAAAGAACTTTCTGTGATAATGG + Intergenic
970608168 4:17701753-17701775 AACCGAACTTTCTGTGATGATGG + Intronic
970700929 4:18737699-18737721 ATTATCATGTTCTGAGATGAAGG - Intergenic
971081200 4:23213583-23213605 AACAGAACTTTCTGCAATGAGGG - Intergenic
971641899 4:29145017-29145039 AAGAGAACTTTCTGGAATGATGG - Intergenic
971818210 4:31517867-31517889 AATAACACAGTCTGAGATTAAGG + Intergenic
971833025 4:31722850-31722872 GATAGAACTTTCTGTAATGATGG + Intergenic
971935278 4:33139512-33139534 AATAGCAATTTCTAAGCTGTAGG - Intergenic
972331550 4:38068814-38068836 AAGAGAACTTTCTGGGATAAGGG - Intronic
972370358 4:38417795-38417817 CACAGAACTTTCTGTGATGATGG - Intergenic
972864991 4:43220945-43220967 GATAGAACTTTCTGCTATGATGG + Intergenic
973006099 4:45008451-45008473 AATAGTACTATCTGATATAAAGG - Intergenic
973553036 4:52054062-52054084 AATAGAACTTTCTATGATGATGG + Intronic
973790091 4:54370260-54370282 AATAGAACCTTCTGCAATGATGG + Intergenic
974449072 4:62027344-62027366 AATAGAACTTTCTGTGATGATGG + Intronic
974496075 4:62629692-62629714 AATAACTTTTACTGAGATGAGGG + Intergenic
975319062 4:72989329-72989351 AATAGAACTTCCAGTGATGACGG + Intergenic
975802151 4:78071589-78071611 AGTAGAGCTTTCTGTGATGATGG + Intronic
976709409 4:88053258-88053280 AAGAGAACGTTCTGTGATGATGG - Intronic
976816575 4:89155222-89155244 AGTAGGACTTTCTGTGATGATGG - Intergenic
976953443 4:90864039-90864061 AATATCACTTTCTTATATCAGGG + Intronic
977163452 4:93665558-93665580 AATAGCAGATTTTGAGGTGATGG - Intronic
977310814 4:95384806-95384828 AATAGCATCTTCGGAGAAGAGGG + Intronic
977599435 4:98920041-98920063 AGGAGAACTTTCTGAGATAATGG - Intronic
978523303 4:109638863-109638885 AATAAAACTTTCACAGATGAGGG - Intronic
978724561 4:111955411-111955433 AGTAGAACTTTTTGTGATGAAGG - Intergenic
980007759 4:127560431-127560453 AATGGGACTTTCTGTGATGATGG - Intergenic
980240290 4:130164605-130164627 AATAGAATTTTCTGTGATGATGG + Intergenic
980251274 4:130318746-130318768 AATAGAACTTCCTGCAATGATGG - Intergenic
980498840 4:133621961-133621983 ATGAGCAATTTCTGTGATGAAGG + Intergenic
980847506 4:138341813-138341835 AATAGAACATTCTGCAATGAGGG + Intergenic
980944623 4:139307194-139307216 AGTAGAATTTTCTGTGATGATGG + Intronic
980948249 4:139345567-139345589 AAAAGCACTTTCTGAGCTTCTGG + Intronic
981107713 4:140900047-140900069 AATGGCAGTTTCTGCCATGATGG + Intronic
981322150 4:143404920-143404942 AACAGAACTTTCTGTGATAATGG - Intronic
981379714 4:144058713-144058735 CCTAGCACTTTGGGAGATGAAGG - Intergenic
981410669 4:144426475-144426497 AGTAGAACTTTCTGTGCTGATGG - Intergenic
981683141 4:147423083-147423105 AATAGAACTTTCTATGATAATGG - Intergenic
981793009 4:148561651-148561673 AATAGAACTTTCTGTGGTGATGG - Intergenic
981977752 4:150751237-150751259 AATAATACTTTCAGAGAAGAAGG + Intronic
982034887 4:151336150-151336172 AATAGAACTTCCTGTGATGATGG + Intergenic
982179133 4:152733799-152733821 AAAAGAACTTTCTGCAATGATGG - Intronic
982311499 4:153990052-153990074 AATAGGACTTTCTATGATAATGG - Intergenic
982628016 4:157792508-157792530 AATAGAACTTTCTGTAATGATGG + Intergenic
982655964 4:158150261-158150283 AATATCTCCCTCTGAGATGAAGG + Intronic
982673156 4:158346547-158346569 AATAGAACTTTCTATGACGATGG - Intronic
982829167 4:160039446-160039468 AATAGAAAGTTCTGTGATGATGG - Intergenic
983251271 4:165349203-165349225 AATGGAACTTTCTGTAATGATGG - Intergenic
983639134 4:169928199-169928221 AGTACAACTTTTTGAGATGATGG + Intergenic
984275850 4:177608083-177608105 AATAGAACTTTCTGCGATGATGG - Intergenic
985169354 4:187131949-187131971 ATTAGCCCTTTGTCAGATGATGG + Intergenic
985332513 4:188854857-188854879 ATTAGCAATGTCTGAGAGGAGGG + Intergenic
985826607 5:2196498-2196520 CATAGGACTTGCTGAGATCAGGG + Intergenic
985975776 5:3418113-3418135 AAGAGCACATTCTGAGATGCTGG - Intergenic
986342921 5:6807115-6807137 TATGGAACTTTCTGTGATGATGG + Intergenic
987598168 5:20028845-20028867 AATTTCACTTTCTGAGATTTCGG - Intronic
987726627 5:21708943-21708965 AATATCACATCCTGATATGAGGG - Intergenic
987916315 5:24219143-24219165 AATAGAACTTTCTGTGATAATGG - Intergenic
987920644 5:24275761-24275783 AGTAGGACTTTCTGAGGTGATGG + Intergenic
988271167 5:29019107-29019129 AATAACACTTTCTGCAATGATGG + Intergenic
988391938 5:30645338-30645360 AATAGTACTTGATGAGATGAGGG - Intergenic
988526931 5:31995374-31995396 AATAGAACTTTCTGTGATCATGG - Intronic
988611893 5:32734669-32734691 AATGGAACTTTCTGCAATGATGG + Intronic
988894087 5:35653419-35653441 ACTTGCACTTTCATAGATGATGG + Intronic
988916286 5:35896944-35896966 CACAGAACTTTCTGAAATGATGG - Intergenic
989066862 5:37472247-37472269 AAGAGAACTTTCTGAGGAGATGG - Intronic
989362442 5:40618165-40618187 AAAAGAACTTTTTGAGATGATGG - Intergenic
989425987 5:41296344-41296366 AACATCACTTTCTGAGAAAAAGG + Intergenic
989450738 5:41583799-41583821 AACAGAACTTTCTGCGATGATGG - Intergenic
989754607 5:44937690-44937712 AATAGTACTTTATGTGATGATGG - Intergenic
990287794 5:54317339-54317361 AATAAAACTTTCTGTAATGATGG + Intergenic
990427469 5:55701166-55701188 AATAGAACTTTCTACAATGATGG - Intronic
990451700 5:55938401-55938423 ATTATCCCTTTCAGAGATGAGGG + Exonic
990530725 5:56670760-56670782 GAAAGAATTTTCTGAGATGAAGG + Intergenic
991008331 5:61854462-61854484 AATAGTATTTTCTGGGATGGTGG + Intergenic
991098175 5:62761817-62761839 AATAGAACTCTCTGCCATGATGG - Intergenic
991266011 5:64719086-64719108 AAGAGAAGTTTCTGTGATGATGG + Exonic
991388820 5:66120654-66120676 AATAGGACTTACTGAAATGATGG + Intergenic
991592780 5:68271683-68271705 ATTAGAGCTTTCTGTGATGATGG - Intronic
992123769 5:73620989-73621011 AACAGAACTTTCTCTGATGATGG + Intergenic
992243893 5:74797736-74797758 AATAGAACTTTCTGCAGTGATGG - Intronic
992391470 5:76335140-76335162 AGTAGCACTTTTGGTGATGATGG - Intronic
992918396 5:81483983-81484005 AATAGAACTTTCTGGGATGATGG - Intronic
992983946 5:82207741-82207763 AATAGAACTTTCTGCAAAGATGG + Intronic
993062689 5:83058623-83058645 AATAAGACTCTATGAGATGAGGG - Intronic
993207856 5:84908071-84908093 AGTGGCAATTTCTGAGATGTTGG + Intergenic
993882745 5:93381845-93381867 CATAAAACTGTCTGAGATGATGG + Intergenic
994384553 5:99114514-99114536 ACTAGAACTTACTGTGATGATGG + Intergenic
994498497 5:100543495-100543517 AATAGAACTTTCTGCAGTGATGG - Intronic
995382595 5:111551263-111551285 AATAGCACTTCCTGAGGAAATGG - Intergenic
995604790 5:113841599-113841621 GAAATCACTTTCTGATATGAAGG + Intergenic
995656942 5:114436798-114436820 AATAGAACTTTCTGCAGTGATGG + Intronic
995682897 5:114740595-114740617 AATAGAACTTTTTGTGATGAGGG + Intergenic
995871242 5:116745568-116745590 AACAGAGCTTTCAGAGATGATGG + Intergenic
996311754 5:122113770-122113792 AATAGAACGTTCTATGATGATGG + Intergenic
996373128 5:122774603-122774625 AATAGAATTTTCTGACATGATGG - Intergenic
996863815 5:128094950-128094972 AATATATCTTTCTGTGATGATGG - Intronic
996895521 5:128477262-128477284 GAAAGAACTTTCTGGGATGATGG - Intronic
997244404 5:132334443-132334465 AATAGAACTTTCTGCAGTGACGG + Intronic
998770480 5:145538533-145538555 AATAGAACCTTCTGTGATGATGG - Intronic
998852208 5:146361852-146361874 AGTAAAACTTTCTGAGATTATGG + Intergenic
999376387 5:151089289-151089311 AACTGCACTTTCTGTGATGATGG - Intronic
999824709 5:155263041-155263063 AGTACCATTTACTGAGATGAGGG - Intergenic
999927895 5:156399005-156399027 AATAGAACTTTCTGAAATAATGG - Intronic
1000180623 5:158807079-158807101 AATTGAACTTCCTGTGATGATGG - Intronic
1000383420 5:160649532-160649554 AATAGAACTTACTGCAATGATGG + Intronic
1001103715 5:168835099-168835121 AATAGAACTTTCTGTGATGAGGG - Intronic
1001126217 5:169021963-169021985 AATAGAACTTTCTGTGATGATGG - Intronic
1001744194 5:174078168-174078190 AACAGAACTTTCTGCAATGATGG - Intronic
1003636149 6:7833161-7833183 AGTAGAACTCTCTGAGATGATGG + Intronic
1003715933 6:8646118-8646140 AATAGAAATTTCTCTGATGATGG + Intergenic
1004191966 6:13471787-13471809 AGTAGAACTTTCTGCAATGATGG + Intronic
1004222631 6:13759569-13759591 GAAAGCAGTGTCTGAGATGATGG - Intergenic
1004688881 6:17974947-17974969 AATAGAACTTCCTGAGATGATGG - Intronic
1004978001 6:20989566-20989588 AATAAAACTCTCTGAGCTGACGG + Intronic
1005084985 6:21996480-21996502 AATAGAACTTTCTGCAGTGATGG - Intergenic
1005116255 6:22340899-22340921 AATAGAACTTTCTGCGGTGATGG - Intergenic
1005995505 6:30928708-30928730 AATAGAACTTTCTGTGATGATGG - Intergenic
1006292613 6:33151524-33151546 GTGAGCACTTTCTGTGATGATGG - Intergenic
1006328158 6:33369794-33369816 AATAGAACTTTCTGCAATGATGG - Intergenic
1006483907 6:34322083-34322105 AATAGAACTTTCTGAAGTGAAGG - Intronic
1006553126 6:34841571-34841593 CAAAGAACTTTCTGTGATGATGG - Intronic
1006596658 6:35198407-35198429 AATAGAACTTTCTGCAGTGATGG - Intergenic
1007237944 6:40404590-40404612 AATAGCACTGCCTGTGTTGATGG - Intronic
1007447431 6:41917886-41917908 AATAGCACTTTCTGTGATGATGG - Intronic
1008370035 6:50721522-50721544 AAAAGGAAGTTCTGAGATGAGGG - Intronic
1008983734 6:57517398-57517420 AATAGAACTTTCTGTGATGATGG + Intronic
1009171792 6:60410307-60410329 AATAGAACTTTCTGTGATGATGG + Intergenic
1009245174 6:61228624-61228646 AATAGAACTTTCTGTGATAATGG - Intergenic
1009532672 6:64840950-64840972 AATACAACTTTCTGTTATGATGG - Intronic
1009899218 6:69791729-69791751 AAAGGAATTTTCTGAGATGATGG - Intronic
1010248797 6:73687062-73687084 AATAGAACTTTCTGTGATGATGG - Intergenic
1010985770 6:82422169-82422191 AATAGAAATTTCTGTGACGATGG - Intergenic
1011133791 6:84077861-84077883 GGTAGAACTTTCTGTGATGATGG + Intronic
1011133920 6:84079409-84079431 AATAAAACTTTCTGGAATGAAGG + Intronic
1011608480 6:89127676-89127698 AATAGAACTTTCTGTAATAATGG + Intergenic
1011704083 6:89983758-89983780 AGTAGCCTTTTCTGTGATGATGG - Intronic
1011772572 6:90691340-90691362 AACAGAACTTTCTGTGATGACGG - Intergenic
1012102917 6:95114268-95114290 ACAAGCCCTTTATGAGATGAAGG - Intergenic
1012299949 6:97573915-97573937 AAAAACACTATCTGAGAAGAGGG + Intergenic
1012426335 6:99118742-99118764 AACAGAACTTTCTGAGGGGAGGG + Intergenic
1012491130 6:99783579-99783601 CACAGCACTTTCTGGGATTAAGG - Intergenic
1012553862 6:100489155-100489177 AATGGCACTGTCTGAGGTGGAGG + Intergenic
1012673500 6:102086936-102086958 AATAGAACTCTCTTTGATGATGG + Intergenic
1013937098 6:115610190-115610212 AATAGAACTTTCTGTGAAAATGG + Intergenic
1014623693 6:123700372-123700394 AAAAGCGTTTTCTGGGATGAAGG + Intergenic
1014885384 6:126774128-126774150 CATAGAACTCTCAGAGATGATGG + Intergenic
1015375937 6:132510679-132510701 AATAGATCTTTCTGTGATAATGG - Intronic
1015595608 6:134863645-134863667 AATAGAACTTCCTGGGTTGATGG - Intergenic
1015654193 6:135498054-135498076 AAGAGCATTTTCGGAGGTGAGGG - Intergenic
1015830296 6:137361813-137361835 AATAGAACATTCTGAAATGATGG - Intergenic
1016164690 6:140925992-140926014 AAAAGAACTTTCTGTGATGATGG - Intergenic
1016268194 6:142256819-142256841 AATAGAAGCTTCTGTGATGATGG + Intergenic
1016427593 6:143950793-143950815 AACAGAACTTTCTGCAATGATGG + Intronic
1016745946 6:147580504-147580526 AATAGGACTTTCTGTAATGATGG + Intronic
1016888601 6:148983173-148983195 AATAGCACATTCTTGGAAGACGG - Intronic
1017646084 6:156541157-156541179 AATAGCACTCTCTGGGGTGAGGG - Intergenic
1018862762 6:167722926-167722948 ACCAGCACTTTCTGAGAGCAAGG - Intergenic
1019367486 7:642282-642304 AAGGGAACTTTCTGGGATGATGG + Intronic
1019409664 7:900974-900996 AATAGCACCATCTGAAAGGAAGG - Intronic
1019788821 7:2997141-2997163 CAAAGCAGTCTCTGAGATGAGGG - Intronic
1019809763 7:3156734-3156756 AGAAGAACTTTCTGTGATGACGG + Intronic
1019878495 7:3837672-3837694 AATAGGAGTTGCTGTGATGATGG + Intronic
1020231102 7:6319426-6319448 AATAGAACCTTCTGTGATGAGGG + Intergenic
1020475561 7:8590008-8590030 AATAGAGCTTTCTGCCATGAGGG - Intronic
1020497162 7:8869896-8869918 AAGATGATTTTCTGAGATGATGG + Intergenic
1020500296 7:8910573-8910595 ATTATCACATTCTGAGATAATGG - Intergenic
1020639578 7:10738778-10738800 AATAGAACTTTCTGTGATGATGG - Intergenic
1021107971 7:16660792-16660814 AATAGAAGTGTCTGTGATGATGG - Intronic
1021120873 7:16794149-16794171 AATAGAAATTTCTGTGATGATGG + Intronic
1021361493 7:19718447-19718469 AATGGATCTTTCTGAAATGATGG + Intergenic
1021824555 7:24535926-24535948 AAAAGGAGTTTGTGAGATGAAGG - Intergenic
1021883983 7:25120602-25120624 AATAGAACTTTCTGTGACGATGG - Exonic
1021905667 7:25330637-25330659 GATAGAACTCTCTGCGATGATGG + Intergenic
1021912872 7:25403899-25403921 AACAGAACTTTCTGGGATAACGG + Intergenic
1022024045 7:26429140-26429162 AATAGAGCTTTCTAAGATGATGG + Intergenic
1022180192 7:27911631-27911653 AATAGGACTTTCTGTGATCGTGG - Intronic
1022212253 7:28223087-28223109 TGTAGAACCTTCTGAGATGATGG + Intergenic
1023006265 7:35871548-35871570 AATAACACTTTCTGAGATGATGG - Intronic
1023020280 7:36005899-36005921 AATAGAACTGTCTGAGAAAAGGG - Intergenic
1023108567 7:36787542-36787564 AAAAGACCTTTCTGAGATGGTGG + Intergenic
1023633006 7:42182124-42182146 AATAGCACTTTCTGTGTTGATGG + Intronic
1024068068 7:45760213-45760235 AATAACACTTTCTGAGATGATGG + Intergenic
1025016786 7:55445935-55445957 AATAGAACTTTCTATGAGGATGG - Intronic
1026094472 7:67332587-67332609 AGTAGAACTTTCTGTGATAATGG - Intergenic
1026571035 7:71530937-71530959 AACAGAACTTTCTGTGATGATGG + Intronic
1027550879 7:79593553-79593575 AACAGAACTTTCTGCAATGATGG - Intergenic
1027782561 7:82537449-82537471 AATAGCACTTTAGAAGATGATGG - Intergenic
1027809699 7:82879633-82879655 AATAGGATTTTCTGAGATCTTGG + Intronic
1028496364 7:91465126-91465148 CAAAGCATTTTCAGAGATGAGGG - Intergenic
1028738568 7:94246502-94246524 AATAGAACTTTCTCTGATAATGG - Intergenic
1028829857 7:95315321-95315343 ATTAGCACATTCACAGATGAAGG - Exonic
1029882985 7:103836451-103836473 AATAGAGCTTTCTATGATGATGG - Intronic
1030028263 7:105345936-105345958 AACAGAACTTTCTGTGATTATGG - Intronic
1030654864 7:112155800-112155822 AAAAGAACTTTCTGTGATAATGG + Intronic
1031003385 7:116443938-116443960 AATAGAGCTTTCTCTGATGATGG + Intronic
1031056776 7:117000287-117000309 AATAGAACTTTCTGCAATAATGG + Intronic
1031175979 7:118350787-118350809 AGTAGAACTTTCTGTGATGATGG + Intergenic
1031319007 7:120297916-120297938 AGTAGAACTTTCTGTGATGATGG + Intronic
1031506031 7:122584725-122584747 AATAGCACTTTCTAAATTTATGG - Intronic
1031672551 7:124567827-124567849 AATAGAACTTCCTGTGATGATGG - Intergenic
1031894072 7:127327828-127327850 AATAGAACTGTCTGGGAAGAAGG + Intergenic
1031907296 7:127474810-127474832 AATAGAACTTTCTGCAATGATGG + Intergenic
1032093198 7:128922310-128922332 AGTAGGACTGTCTGCGATGATGG + Intergenic
1032261870 7:130344760-130344782 AATAGAACTTTCTGTGATAATGG - Intergenic
1032487894 7:132301831-132301853 AATAACACTGTCTCAGCTGATGG + Intronic
1032637413 7:133725046-133725068 AATAGCACTTTCTGTGATGATGG + Intronic
1032689866 7:134274051-134274073 AATAGAGCTTTCTGTGATGATGG + Intergenic
1032856014 7:135834148-135834170 TTGAGCTCTTTCTGAGATGAGGG - Intergenic
1033295075 7:140125332-140125354 AATACAACTTTCTGTGCTGATGG + Intronic
1033760961 7:144436200-144436222 AATAGAACTTTCTGTGATGATGG + Intergenic
1035279764 7:157770388-157770410 TTAAGCACTTTCTGAGGTGAGGG + Intronic
1035588740 8:797177-797199 CACAGGACTTTCGGAGATGACGG - Intergenic
1037318470 8:17621698-17621720 AATAGAACTTTCTGTGATAAAGG - Intronic
1037437887 8:18882968-18882990 AATAGAGCTTTCTGTGATGACGG - Intronic
1037663778 8:20949889-20949911 AATTGCATTTTTTGAAATGATGG - Intergenic
1037713099 8:21371271-21371293 AATGGAACTGTCTGTGATGAAGG + Intergenic
1037719363 8:21429789-21429811 GATGGCAGTTTCTGAGCTGATGG + Intergenic
1038357405 8:26842119-26842141 AACAGAACATTCTGAGAGGATGG + Intronic
1038900387 8:31835835-31835857 AGTAGAACTTTTTGGGATGATGG + Intronic
1039170683 8:34741512-34741534 AATAACAGGTTCTGAGATTAAGG + Intergenic
1039379225 8:37069220-37069242 AGTAGAACTTTCTGTGATGATGG - Intergenic
1039710347 8:40049923-40049945 ATTAAGACTTTCTGAGATGAAGG - Intergenic
1039816970 8:41102739-41102761 AAAAGCACTTTAGGAGATCAGGG + Intergenic
1040637271 8:49289884-49289906 AATAGCCCTTTGTGAGAAGCAGG + Intergenic
1040777166 8:51058921-51058943 AATAGTATTTTCTATGATGAAGG - Intergenic
1041203142 8:55471198-55471220 GATAGAACTTTCTGTGAGGATGG - Intronic
1041449260 8:57989984-57990006 AATAGAACTTTCTGCAATGATGG + Intergenic
1041532438 8:58885099-58885121 GATAGCACTTTCTGAAAATAAGG + Intronic
1041593565 8:59619957-59619979 AATAGGACTCTCTGGAATGAAGG - Intergenic
1042134512 8:65620175-65620197 ATCAGAACTTTCTGAGATGATGG + Intronic
1042155117 8:65836846-65836868 AGTAGAACTTTCTGTGATGATGG - Intronic
1042189539 8:66171651-66171673 AATAGCACTTTCTGTGATAAAGG + Intronic
1042371993 8:68002428-68002450 GAGAGCACTTTGTGAGATGGAGG - Intronic
1042610362 8:70592791-70592813 AATAGAACTTTCTGCAATCATGG + Intronic
1042786493 8:72552325-72552347 AATAGAACTTGATGTGATGATGG + Intronic
1043265383 8:78260637-78260659 AATAGAACTTTCTGTGTTAATGG - Intergenic
1043455859 8:80411471-80411493 AATAGAACTTTCTGCAATGATGG + Intergenic
1043477571 8:80620066-80620088 CATGGAACTTTCTGTGATGATGG - Intergenic
1043596629 8:81895196-81895218 AATGTAACTTTCTAAGATGATGG - Intergenic
1044420677 8:91992529-91992551 TATAGAACTTTCTGTGATGATGG - Intronic
1044457828 8:92409408-92409430 AAAAGAAGTTTCTGAAATGATGG - Intergenic
1044567386 8:93679378-93679400 AATAGCTCTGTCTGAGATGCTGG - Intergenic
1044571595 8:93724840-93724862 AGAAGAACTTTCTGAGATGATGG - Intronic
1044662511 8:94605479-94605501 ATTGGCACTATCTAAGATGAGGG + Intergenic
1045134660 8:99202523-99202545 AATAACAATTTCTGAAATTAAGG + Intronic
1045230437 8:100301211-100301233 AATAGAACTTTCTGTGGTGAAGG - Intronic
1045458575 8:102406957-102406979 AAGAGAACTTTCAGTGATGATGG + Intronic
1045683567 8:104688447-104688469 AATAGCAATTTCTGTAATGGAGG - Intronic
1045714422 8:105025086-105025108 AATAGAACTTTCTGCAGTGATGG - Intronic
1046151371 8:110230764-110230786 AATAGAACTTTATGAGATGATGG - Intergenic
1046235428 8:111418084-111418106 AGTAGTACTTTCTGAGATTTTGG - Intergenic
1046564565 8:115882737-115882759 ATTAGAACTTTCTGCGATGATGG - Intergenic
1046583990 8:116128856-116128878 AACAGAACTTTCTGCAATGATGG + Intergenic
1046920781 8:119726075-119726097 AATAGAACTTACTGTGATGCTGG + Intergenic
1047124979 8:121949797-121949819 AATAGACCTTACTGAGGTGATGG + Intergenic
1047985969 8:130234169-130234191 AACAGGACTTCCTGTGATGATGG + Intronic
1048191769 8:132296196-132296218 AAGAGAATTTTCTGTGATGATGG - Intronic
1049890651 9:67304-67326 AATAGAAGTTTCTTTGATGATGG - Intergenic
1050039324 9:1472311-1472333 AATAAAACTTTCTGTGATGATGG - Intergenic
1050162564 9:2733579-2733601 AATAGAACTTTCTGTAATGATGG + Intronic
1050178207 9:2891618-2891640 AATAGCAATTTTTAATATGAGGG + Intergenic
1050283386 9:4075999-4076021 ATTAGTACTTTGTGAGGTGATGG + Intronic
1050430971 9:5561284-5561306 AGTAGAACTTTCTGCAATGATGG - Intronic
1050758145 9:9033428-9033450 AATTCCCCTTTCTGAGATGTGGG - Intronic
1051090034 9:13395791-13395813 AATAGAACTTCCTATGATGATGG + Intergenic
1051951086 9:22633907-22633929 AAAATAACTTTCTGTGATGATGG + Intergenic
1052033352 9:23653312-23653334 AATAGCCCTTTATCAGATAATGG + Intergenic
1052166177 9:25331620-25331642 ATTAGCAATTTCTCAGATCAAGG + Intergenic
1052247826 9:26359406-26359428 AATAGACCTTTTTGGGATGATGG - Intergenic
1052257708 9:26478304-26478326 AATAGCAATTTCTGAGAGTCAGG - Intergenic
1052803775 9:32994150-32994172 AATAGAATTTTCTGCAATGACGG + Intronic
1052838300 9:33268077-33268099 AATAGAACTTTTTGCCATGATGG + Intronic
1053724905 9:40989722-40989744 AATAGCACATTGTAAGTTGAGGG - Intergenic
1053732120 9:41068486-41068508 AATAGAAGTTTCTTTGATGATGG - Intergenic
1054341063 9:63862279-63862301 AATAGCACGTTGTAAGTTGAGGG + Intergenic
1054696335 9:68363231-68363253 AATAGAAGTTTCTTTGATGATGG + Intronic
1054768219 9:69060427-69060449 TGTAGCAGTTTCTGAGATGCAGG - Intronic
1054990293 9:71317778-71317800 AAAAGTATTTTGTGAGATGAAGG - Intronic
1055344560 9:75321608-75321630 AATAGAACTTTTTGCAATGATGG - Intergenic
1055507255 9:76961148-76961170 AGTAGAGCTTTCTGAAATGATGG + Intergenic
1056984452 9:91348723-91348745 ATTAGTACTTTCAGAGATCAGGG + Intronic
1057459191 9:95244238-95244260 AGTAGCAGTTGCTGAGAGGAAGG - Intronic
1057524945 9:95790508-95790530 AGTAGAACTTTCTGTGCTGATGG - Intergenic
1057622987 9:96653603-96653625 AAAATCACTATCTGACATGATGG + Intronic
1057727636 9:97579372-97579394 AATAGAACTTCCTGTGATGATGG + Intronic
1057978702 9:99635615-99635637 AATAGAACTTTCTAAGATAATGG + Intergenic
1058153742 9:101488837-101488859 CATAGAACTTTCTGTGATGATGG - Intronic
1058373426 9:104295845-104295867 AACAGAACTTTCTGTGATGATGG + Intergenic
1059251072 9:112888638-112888660 AATAGAACTTTCTAGAATGATGG - Intronic
1059412485 9:114141292-114141314 AGTAGAACTTTCTGCGAGGATGG + Intergenic
1059590468 9:115654171-115654193 AATAGAAATTTCTGTGATGAAGG - Intergenic
1059941444 9:119363901-119363923 AATAGAACTGTCTGTGATGATGG - Intronic
1059942945 9:119375749-119375771 AATCTCACTTTTTGTGATGATGG + Intergenic
1060075698 9:120588841-120588863 AACAGAACTTTCTTGGATGATGG + Intergenic
1060137837 9:121174502-121174524 AACAGAACTTTCTGCAATGATGG - Intronic
1060687736 9:125626630-125626652 AGTAGAACTTTCTATGATGACGG - Intronic
1061113193 9:128590284-128590306 AGTAGAACTTTCTGTGATGGTGG + Intronic
1061505142 9:131027485-131027507 AGCAGCACTTTCTGTGATGACGG + Intronic
1061651228 9:132051776-132051798 AATAGAACTTTATGTGATGATGG - Intronic
1062094640 9:134696530-134696552 AGTATCACTTTCTGAGGTCAGGG + Intronic
1062337594 9:136079224-136079246 AACTGCACTCTCTGAGCTGAGGG + Intronic
1203449910 Un_GL000219v1:102268-102290 AATAGCACATTGTAAGTTGAGGG + Intergenic
1186258094 X:7744610-7744632 AAGAGGACATTCTGAGATGAAGG - Intergenic
1186599388 X:11020635-11020657 AATAACAGTTTCTGAAATGGAGG - Intergenic
1186761497 X:12728030-12728052 AATAGAACTCTCTGTGATGATGG + Intergenic
1186846540 X:13536380-13536402 AATAGAACATTCTGTGATGATGG - Intergenic
1186996906 X:15133266-15133288 AATAGAAGTTTCTGTGATTATGG - Intergenic
1187053476 X:15717403-15717425 AATGGGACATTCTGTGATGATGG + Intronic
1187060406 X:15781558-15781580 AATAGAACTTTCTGCAATGACGG - Intronic
1187174467 X:16883530-16883552 AATGGAACTTTCTGCAATGATGG + Intergenic
1187218101 X:17296633-17296655 AATAAAACTTTCTGCAATGATGG + Intergenic
1187237222 X:17478753-17478775 AATAGGATTTTCTGTGATGCTGG + Intronic
1187252080 X:17607626-17607648 AATAGAACTTTCTATGATGATGG + Intronic
1187279797 X:17849350-17849372 AGTAGAACTTTCTGCAATGATGG - Intronic
1187280610 X:17856022-17856044 AATAAAACTTTCTATGATGATGG - Intronic
1187531787 X:20103785-20103807 AGTAGAACTTTCTGTGATGTTGG - Intronic
1187613904 X:20972467-20972489 AATAGCACTTTCTGGGATGATGG - Intergenic
1187753498 X:22494115-22494137 AACAGAACTTTCTGTGATGATGG + Intergenic
1187821414 X:23292196-23292218 AGTAGAATTTTCTGTGATGATGG - Intergenic
1187920542 X:24197097-24197119 AACAGAACTTTCTTTGATGAAGG - Intronic
1187983396 X:24783936-24783958 AATAGTACTTCCTGCAATGATGG - Intronic
1188152207 X:26691412-26691434 AATAGAACTTTCTGTCATTATGG + Intergenic
1188359113 X:29230828-29230850 ATTTGAACTTTCTGTGATGAGGG + Intronic
1188467725 X:30500991-30501013 GAGAGATCTTTCTGAGATGATGG + Intergenic
1188628576 X:32320525-32320547 TATAGAACTTTCTGAGATGATGG - Intronic
1188938296 X:36204652-36204674 AAAAGCACTTTCTCAAATGCTGG + Intergenic
1189222873 X:39387902-39387924 AATAGAACTTTCTGAGATGATGG - Intergenic
1189399389 X:40652329-40652351 AATAGAACTTTTTGTGATGATGG + Intronic
1189428325 X:40923322-40923344 AATAGCAGTGAGTGAGATGAAGG + Intergenic
1189507999 X:41632441-41632463 AATAGAACTATCTGTGATGAAGG + Intronic
1189532797 X:41903742-41903764 AACAGAACTTTCTGTGATGATGG + Intronic
1189918041 X:45876331-45876353 CACAGCACTCTCTGAAATGAAGG + Intergenic
1189965109 X:46364729-46364751 AATAGAACTTTCTGCAATTATGG - Intergenic
1191135081 X:57055414-57055436 AATAACAAGTTCTGAAATGAAGG - Intergenic
1191730698 X:64332009-64332031 AATAGAACTTTCTGCAATGATGG + Intronic
1192111031 X:68364798-68364820 AATAGAACTTTCTGTGATTATGG - Intronic
1192896694 X:75450309-75450331 GACAGAACTTTCTGAGGTGATGG + Intronic
1193129523 X:77904971-77904993 AATAGAACTTCTTGAGCTGAAGG - Intronic
1193416766 X:81235043-81235065 AAAGGGACTCTCTGAGATGAGGG - Intronic
1193861766 X:86676505-86676527 AATAGAACTTTCTGCGATGATGG + Intronic
1194193821 X:90868441-90868463 AATAACATTTTCTGAAATCAAGG + Intergenic
1194607309 X:95996857-95996879 AATAGTACTATCTGACATGCAGG + Intergenic
1194807953 X:98353090-98353112 AATAGAACATTCCAAGATGATGG + Intergenic
1194809318 X:98371433-98371455 AATAGATCTTTCTGTGATGATGG + Intergenic
1194852278 X:98884260-98884282 AATAGCAATTTCTGAAATTCAGG + Intergenic
1194972976 X:100364478-100364500 AGTAGAACTTTCTGTGATGATGG - Intronic
1195030445 X:100922550-100922572 GATAGAACTTTCTGTGATGATGG + Intronic
1195073642 X:101305273-101305295 AATAGAATTTCCTGTGATGATGG + Intergenic
1195372743 X:104196157-104196179 AACAGAACTTTCTGTGATGATGG - Intergenic
1195734060 X:107995274-107995296 AATAGAACTTTCTGTGGTGATGG - Intergenic
1195739466 X:108048863-108048885 AACAGAACTTCCTGTGATGATGG - Intronic
1195744143 X:108097416-108097438 AGTAGAACTTTCTGTGATGATGG + Intronic
1195843482 X:109200842-109200864 AATAGTATTTTCTGCAATGATGG + Intergenic
1195997195 X:110743165-110743187 AATAGAACTTTTTGCAATGATGG - Intronic
1196624639 X:117864264-117864286 AATAAAACTTTCTGAGCTGATGG - Intergenic
1196710151 X:118754048-118754070 AACAGAACTTTCTGGGATTATGG - Intronic
1197153329 X:123243932-123243954 CATAGCAATGTCAGAGATGACGG - Intronic
1197490405 X:127109635-127109657 AATAACAAATTCTGAAATGAAGG + Intergenic
1197698047 X:129571952-129571974 AATAGAGCTTTCTGTGATGATGG + Intronic
1197825353 X:130584370-130584392 AAGATCACATTCTGAGATTATGG + Intergenic
1197834772 X:130682769-130682791 AATAGCATTTGCTGAGATTTAGG + Intronic
1198207595 X:134482456-134482478 AATAGAACTTTCTTTGAGGATGG + Intronic
1198374280 X:136022418-136022440 AACAGAACTTTCTGCAATGATGG - Intronic
1198808989 X:140516100-140516122 GAGAGCACTCACTGAGATGATGG + Intergenic
1198810516 X:140531424-140531446 AACAGAACTTTCTGCAATGATGG - Intergenic
1199651888 X:149953388-149953410 CAAAGCAATTTCTGAGGTGATGG - Intergenic
1199684324 X:150253135-150253157 AATGGAATTTTCTGAGATCATGG + Intergenic
1199753418 X:150842833-150842855 TATGGAACTTTCTGTGATGATGG - Intronic
1199791923 X:151162882-151162904 AGCAGAACTTTCTGTGATGATGG - Intergenic
1199975353 X:152891916-152891938 CCTAGAACTTTCTGTGATGATGG + Intergenic
1200272381 X:154698159-154698181 AACAGAACTTTCTGTGATGTTGG - Intronic
1200540430 Y:4450825-4450847 AATAACATTTTCTGAAATCAAGG + Intergenic
1200836393 Y:7736254-7736276 AAGACAACTTTCTGAGATGATGG - Intergenic