ID: 1144051494

View in Genome Browser
Species Human (GRCh38)
Location 17:11500835-11500857
Sequence ACTTGGGTCTACAGGGAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144051485_1144051494 25 Left 1144051485 17:11500787-11500809 CCCATCATCTCAGAAAGTGCTAT 0: 1
1: 0
2: 5
3: 35
4: 221
Right 1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 134
1144051486_1144051494 24 Left 1144051486 17:11500788-11500810 CCATCATCTCAGAAAGTGCTATT 0: 1
1: 13
2: 63
3: 247
4: 726
Right 1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG 0: 1
1: 0
2: 1
3: 7
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144051494 Original CRISPR ACTTGGGTCTACAGGGAAAC TGG Intronic
907440913 1:54477635-54477657 ACTCGGGTGAACAGTGAAACAGG + Intergenic
907866148 1:58401204-58401226 ACTTGGGTCTTCCAGGACACGGG - Intronic
917829895 1:178871096-178871118 ACTTGAGTCTACTGAGAAAGAGG - Intronic
923022953 1:230179270-230179292 ACTTATGTCTACACGAAAACTGG - Intronic
923401956 1:233624312-233624334 ACTTGGGGCTACTGAGAAGCAGG + Intronic
1067682487 10:48449780-48449802 GCTTGGTTCAGCAGGGAAACTGG + Intronic
1070486245 10:76934580-76934602 AATGGGGTCTACAGGCAAAAGGG - Intronic
1072454668 10:95565202-95565224 ACCTGGGTCCACAGGGAAACGGG + Intergenic
1072467550 10:95680557-95680579 ACCTGGATCTCCAGGGAAACTGG + Exonic
1073357752 10:102870399-102870421 ACTTGGGACTACAGGCTCACTGG - Intronic
1076946292 10:133653348-133653370 TCTTGGGTGGACAGGCAAACAGG + Intergenic
1078473656 11:11611918-11611940 ATTTGTGTCTACAAGGAACCTGG - Intronic
1078944087 11:16044184-16044206 ATTTGGGTTTCCTGGGAAACAGG - Intronic
1080331465 11:31144533-31144555 ACTAGTGAATACAGGGAAACTGG - Intronic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1083902658 11:65651099-65651121 ATTTGGTTCTGCAGGGAAGCAGG + Intergenic
1085996966 11:81929536-81929558 ACTTGGATCTACCTGTAAACTGG + Intergenic
1088560966 11:111115987-111116009 ACATGGCTCTCCAGGGAAAAGGG - Intergenic
1091667601 12:2430644-2430666 GCTTGGGTTTACAGGGGAAAGGG - Intronic
1091997384 12:5004386-5004408 ACTAGGGTCCACAGTGAAACTGG - Intergenic
1092023850 12:5224422-5224444 ATTTGGGGCTACATGGAGACAGG - Intergenic
1092389127 12:8059922-8059944 ACTTGGCTCTCCAGGGACAGTGG - Exonic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1096788632 12:54031784-54031806 ACTTGGGGCTACGGGGGAAGAGG + Intronic
1100840452 12:98607480-98607502 AGGTGGGTCTACGGAGAAACAGG + Intergenic
1106055395 13:26232224-26232246 AGTTGGGACTACCTGGAAACTGG + Intergenic
1107511297 13:41088102-41088124 AACTGGGACTACAGGCAAACAGG + Intergenic
1108013891 13:46052749-46052771 GCCTGGGTCTACAGAGGAACAGG - Exonic
1111351327 13:87035180-87035202 TCTTTGGTCTACTGGGAGACAGG + Intergenic
1111985937 13:95067055-95067077 ACATGGGGCAACTGGGAAACAGG + Intronic
1113950811 13:114069972-114069994 ACTTGGGGGAACCGGGAAACTGG + Intronic
1113950859 13:114070085-114070107 ACTTGGGGGGACCGGGAAACTGG + Intronic
1118398584 14:65358566-65358588 ACTTCGGTCTACAGAGTAACTGG + Intergenic
1119846555 14:77834783-77834805 ACCTGGTTCTACAGGGTAAGTGG + Intronic
1120720083 14:87881113-87881135 AGCTGGGTCTTCAGGGAGACAGG - Intronic
1121962583 14:98275059-98275081 GCATGGGTCTGCAGGGAAAGGGG - Intergenic
1202920398 14_KI270723v1_random:25974-25996 TCTTGGGTGGACAGGCAAACAGG + Intergenic
1202924532 14_KI270724v1_random:11673-11695 TCTTGGGTGGACAGGCAAACAGG - Intergenic
1124890296 15:33726229-33726251 ACTTGTGGCCACAGGGAAAGAGG - Intronic
1125619367 15:41046070-41046092 ACTTGTTTCTACAGGGCAAACGG - Intronic
1129003574 15:72353829-72353851 ATTTGGGTACACAGGGAAAATGG + Intronic
1130734515 15:86534184-86534206 AGTCAGGTCTACAAGGAAACTGG + Intronic
1130760720 15:86816714-86816736 ACTTGGCACAACTGGGAAACTGG + Intronic
1131118897 15:89810957-89810979 ACTTGTGTCTCCAGGGCAAGTGG - Intronic
1132617009 16:846544-846566 ACGTGGGTTTACAGGAAACCGGG - Intergenic
1137520563 16:49191590-49191612 AACTGGGTCTCCAGGGAAAGGGG + Intergenic
1138839997 16:60489000-60489022 ACTTGGTTCTATAGGAAAAAAGG + Intergenic
1139000962 16:62509334-62509356 ATTAGGGTATACATGGAAACAGG + Intergenic
1139243581 16:65419246-65419268 CCTTGGGTCTACAGAGACCCAGG - Intergenic
1140474133 16:75230136-75230158 GCATGGGACTGCAGGGAAACGGG + Intronic
1142473110 17:174065-174087 TCTTGGGTCTGCAGGGAAATTGG + Intronic
1142737084 17:1907899-1907921 AAATGGCTCTCCAGGGAAACGGG + Intergenic
1144051494 17:11500835-11500857 ACTTGGGTCTACAGGGAAACTGG + Intronic
1144441657 17:15287967-15287989 CATTGGTTCTACAGGCAAACAGG + Intergenic
1146496809 17:33329913-33329935 ACTTGGGGCAAGAGGGGAACGGG + Intronic
1146832399 17:36081508-36081530 CCTGGGGTCTGCAGGGAACCAGG - Intergenic
1150280689 17:63928298-63928320 CCTTGGTTCTCCAGGCAAACTGG - Intergenic
1151068539 17:71180925-71180947 TCTTGGGTTTACAGGGACAGAGG - Intergenic
1154977375 18:21473043-21473065 ACTTGGGTCTGGAGGAAAATGGG + Exonic
1155017324 18:21857353-21857375 ACTTGGATCCACAGTGGAACAGG + Intronic
1157569853 18:48705083-48705105 ACTGTGGTCTCCAGGGAAGCAGG + Intronic
1158973409 18:62688874-62688896 ACCTTGGTCTACAAGGCAACAGG - Intergenic
1162503233 19:11066659-11066681 ACTTGTGTCATCTGGGAAACAGG - Intergenic
1164884872 19:31769978-31770000 AATTGGGCCTCCAGGGACACAGG - Intergenic
1167058761 19:47130427-47130449 ACATGGGGCTACAGAGTAACAGG - Intronic
926402999 2:12518878-12518900 ATTTGGGTCAAAAGGGAAAGTGG - Intergenic
927437579 2:23082661-23082683 ACTTGAGTCCACAGGAAAAAAGG - Intergenic
929031641 2:37654687-37654709 ACATGGGACTACAAGGAAATTGG - Intronic
931572566 2:63684270-63684292 ACTTGGGCCTACAGCAAAAAGGG - Intronic
933743294 2:85551875-85551897 ACTTGGCCCTCCAGGGAGACAGG + Exonic
935622001 2:105138262-105138284 TCAGGGTTCTACAGGGAAACAGG + Intergenic
937419001 2:121739174-121739196 ACTGGGGTGTACAGAGAAAGTGG - Intronic
938880476 2:135581271-135581293 CTGTGGATCTACAGGGAAACAGG - Intronic
940980002 2:159990867-159990889 ATTTGGGTCTACTGTGAGACAGG + Intronic
941652056 2:168102436-168102458 TGTTGGGTATACAAGGAAACTGG + Intronic
942738470 2:179144187-179144209 ATTTTGCTCTACAGGGAAATAGG - Intronic
944153985 2:196592625-196592647 GTTTGGTTCTCCAGGGAAACTGG - Intronic
1174588075 20:51624183-51624205 AATTGGGTTTACAAGGAAACAGG + Intronic
1177421758 21:20868351-20868373 ACTTGGGTCTACATGGAGCTGGG + Intergenic
1177681220 21:24374140-24374162 AATTTTGTATACAGGGAAACTGG - Intergenic
1178880005 21:36441930-36441952 ACTTGGGCTGAGAGGGAAACAGG - Intergenic
1179570042 21:42273289-42273311 CCTTGGTTCTGCAGGGAGACGGG + Exonic
1180253109 21:46602691-46602713 GGTTGGGCCAACAGGGAAACTGG + Intronic
1181441777 22:22939822-22939844 AGTTGAGGCTACAGGGACACAGG + Intergenic
1183054501 22:35295312-35295334 AATTGGGAATACAGAGAAACAGG + Exonic
1183445252 22:37849346-37849368 ACTCGGGCCTGCCGGGAAACCGG - Exonic
1183960676 22:41410211-41410233 ACTTGGGGGCACAGGGAAGCTGG + Intergenic
950822629 3:15777369-15777391 ATTTGGTTCTACACGGAATCAGG + Intronic
951823602 3:26842384-26842406 ACCTGAGTCTGCAGGGAACCTGG + Intergenic
953042186 3:39265405-39265427 CCTTGTGTCTACAGAGAACCTGG - Exonic
953126751 3:40097737-40097759 ACTTCTGTCTACAGAGACACAGG - Intronic
954421564 3:50421623-50421645 CCTTGGTACTACAGGGACACAGG + Intronic
957081187 3:75637113-75637135 TCTTGGGTGGACAGGCAAACAGG - Intergenic
962329888 3:134468550-134468572 ACTTTGGTCTTCAGGAAAAGGGG - Intergenic
964472457 3:157069739-157069761 ACTTGGGGGTAGAGGGATACAGG + Intergenic
969946822 4:10791574-10791596 ACTAGGGTCTTCAGGGGAACAGG + Intergenic
970756448 4:19432575-19432597 ACTTGGGTCTACAGAAAGAAGGG + Intergenic
971545691 4:27882200-27882222 AGTTGGGAAAACAGGGAAACTGG - Intergenic
978171069 4:105670871-105670893 ACTTGGCTCTACAGGGACTTTGG + Intronic
980559343 4:134452397-134452419 TCTTTGTTCTACTGGGAAACAGG + Intergenic
981432026 4:144672373-144672395 TCTTGAATGTACAGGGAAACAGG + Intronic
985449706 4:190054000-190054022 TCTTGGGTGGACAGGCAAACAGG + Intergenic
987947897 5:24637188-24637210 ACTTGGGAAGACAGGGAAAGAGG - Intronic
995752065 5:115462460-115462482 ACTTGGGGCTACAGAGATAGGGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
1000041255 5:157486704-157486726 ACTTGGGGTTACAGGAGAACAGG - Intronic
1006947006 6:37791367-37791389 CCCTGGGTCTACAGGAGAACAGG - Intergenic
1007447740 6:41920269-41920291 TCTTGGGTCTAGAGGAAAAAAGG - Intronic
1007616831 6:43184785-43184807 ACTGGTGTCTTCAGGGAGACAGG + Exonic
1011743813 6:90389397-90389419 GCTGGGGCCTTCAGGGAAACTGG + Intergenic
1012740477 6:103009858-103009880 ACTTCAGTCTACAAGGAAAAAGG + Intergenic
1012974296 6:105763512-105763534 ACCTGGGTCTTCAGGGGAAGTGG - Intergenic
1015467246 6:133560657-133560679 ACTTTAGTCTAGAAGGAAACAGG + Intergenic
1016800873 6:148167815-148167837 CCTTATGTCTACAGAGAAACTGG - Intergenic
1020431247 7:8118589-8118611 ATTTGGGTCTAGAAGGAAAATGG - Intronic
1026137055 7:67672785-67672807 ACTTGGGTGTATTGGGTAACTGG + Intergenic
1028205572 7:88012960-88012982 CCTTGGCTCTAGAGGGAAAGAGG - Intronic
1032448463 7:132004705-132004727 ATTTGCTTCTACAGGGAGACAGG + Intergenic
1032490081 7:132318014-132318036 ACTCGGGTCTTCAGGGAAAATGG - Intronic
1033636548 7:143217507-143217529 ACTTGGGGCAACAGGAAAAGTGG - Intergenic
1033835560 7:145306449-145306471 TCTTGGGTCTACTGGTGAACTGG + Intergenic
1034461751 7:151201384-151201406 GCTTTGGTCTACAGGGGAAGTGG + Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1036022987 8:4869317-4869339 AGTTGTGTCTGTAGGGAAACTGG + Intronic
1040683297 8:49839723-49839745 ATTTGGGTCTACAAGGAATATGG - Intergenic
1044025808 8:87170678-87170700 AGCTGGGTATACAAGGAAACTGG - Intronic
1044843358 8:96356761-96356783 GCATGGGTTTACAGGGAAAAGGG + Intergenic
1048908941 8:139115862-139115884 AGCTGGCTCTACAGGGAAAAAGG + Intergenic
1050797657 9:9564353-9564375 ACTTGTTTCTAAAGGGTAACAGG - Intronic
1056453226 9:86736550-86736572 ATTCTGGTCAACAGGGAAACTGG + Intergenic
1057985571 9:99710337-99710359 ACCTGGGTCTAAAGTTAAACAGG - Intergenic
1059691436 9:116688709-116688731 GCTTGGGGGTACAGGGAAAAAGG - Intronic
1060551536 9:124487761-124487783 AGCTGGGGCTCCAGGGAAACTGG - Intronic
1061547183 9:131311255-131311277 CCTTGGGTCTTCATGGAAAGGGG - Intergenic
1187250444 X:17593417-17593439 CCTTTGGTCTTCAGGAAAACAGG + Intronic
1190907263 X:54739261-54739283 ACTTGGGACTACACAGAAATGGG - Intergenic
1192591536 X:72363986-72364008 CCTTGGTTCAACAGGGAAGCAGG + Intronic
1193133631 X:77945591-77945613 ACATGTGTCTACAGGGACTCTGG - Intronic
1193249487 X:79271988-79272010 ACTTGGGACTTCAGGGATAATGG - Intergenic
1195269564 X:103215926-103215948 AGATGGATCTACAGGGAAAATGG + Intronic
1195321657 X:103726142-103726164 ACATGGATCTACTGGGAAAGAGG - Intronic
1201771100 Y:17617768-17617790 TCTTGGGTGAACAGGCAAACAGG + Intergenic
1201830455 Y:18288218-18288240 TCTTGGGTGAACAGGCAAACAGG - Intergenic