ID: 1144052817

View in Genome Browser
Species Human (GRCh38)
Location 17:11511575-11511597
Sequence CTGAACCAGGCATTTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 241}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144052817 Original CRISPR CTGAACCAGGCATTTTTTTG GGG (reversed) Intronic
900467397 1:2832574-2832596 CTGATCCATGCATGTTTATGGGG - Intergenic
902703963 1:18191742-18191764 TTGAACCTGGCATCTGTTTGGGG + Intronic
904071893 1:27806397-27806419 CTGAACTAGCCACTTTTTTTAGG - Intronic
905569389 1:38991634-38991656 CAGGCCCAGGCATTTTTTGGGGG + Intronic
907823286 1:57991387-57991409 CTTAGCCAGGCATTGTTCTGGGG + Intronic
907841874 1:58166283-58166305 CAGACACAGGCATCTTTTTGGGG - Intronic
908805857 1:67931164-67931186 CTGTACCTGGACTTTTTTTGTGG + Intergenic
908909668 1:69058655-69058677 CTCCCCCAGGCATTTGTTTGAGG - Intergenic
910323144 1:85972729-85972751 CTGGACCAGTCATTTTTTCTGGG - Intronic
910423272 1:87093044-87093066 CTGAAGCAGCTATTTTTTTCTGG + Intronic
911383911 1:97150535-97150557 CTCACCCAGGCATTTTCTTGTGG + Intronic
911644955 1:100328064-100328086 CTGCACCTGGCATGTTTTTCTGG + Intergenic
911645278 1:100331390-100331412 TTTAACCACACATTTTTTTGTGG - Intergenic
911804918 1:102194011-102194033 CTGAGTCAGTCATTTATTTGTGG + Intergenic
912208744 1:107535688-107535710 CTGAACCAGGCATTTTCCATTGG - Intergenic
913000057 1:114571349-114571371 CTGTACCCAGCTTTTTTTTGCGG + Intronic
913547512 1:119884054-119884076 CTGAACAAGGCAAGTTTTTGAGG - Intergenic
913648908 1:120890595-120890617 CTGAAACAGGCGATTTTTAGGGG + Intergenic
914077783 1:144372788-144372810 CTGAAACAGGCGATTTTTAGGGG - Intergenic
914101396 1:144593717-144593739 CTGAAACAGGCGATTTTTAGGGG + Intergenic
914172692 1:145241328-145241350 CTGAAACAGGCGATTTTTAGGGG - Intergenic
914219466 1:145666414-145666436 TTGAACGAAACATTTTTTTGAGG - Intronic
914297584 1:146343919-146343941 CTGAAACAGGCGATTTTTAGGGG - Intergenic
914527349 1:148482461-148482483 CTGAAACAGGCGATTTTTAGGGG - Exonic
914639045 1:149584672-149584694 CTGAAACAGGCGATTTTTAGGGG + Intergenic
915182875 1:154078302-154078324 CTGTACCTGGCCTTTTTTTTTGG - Intronic
915513894 1:156401736-156401758 CAGAACTAGCCATTTTTTTTTGG + Intergenic
916249048 1:162718268-162718290 CAGAATCAGCCATTTTTCTGAGG + Intronic
918994073 1:191733159-191733181 CTGTACAAGGAATTTTTTTAGGG - Intergenic
920334928 1:205238640-205238662 TTGACCCAGGCATTTTTGTTTGG + Intronic
920576687 1:207066099-207066121 CTGAGTCAGGCATGTTCTTGAGG - Intronic
921611704 1:217219763-217219785 CTGAACCAGCAATTTATTTCTGG - Intergenic
921908070 1:220516335-220516357 CTGACTCAGTCATTCTTTTGTGG + Intergenic
923260396 1:232262373-232262395 ATGAACCAGGCATAGCTTTGGGG - Intergenic
923861398 1:237895263-237895285 GATAACCAGGCATTGTTTTGTGG - Intergenic
1063312341 10:4965653-4965675 CTGAACCTGAAATTGTTTTGGGG + Intronic
1064753104 10:18552339-18552361 GTCAAACAGGCATTTTCTTGGGG - Intronic
1065332234 10:24614384-24614406 ATAAACCAGGCATTTGTTAGGGG + Intronic
1065592450 10:27279150-27279172 CTGAACCAGAAATGTCTTTGTGG - Intergenic
1065657904 10:27971211-27971233 CTGAACCAGAAATGTCTTTGCGG + Exonic
1065707620 10:28485463-28485485 CTGACTCTGGCATTTTTTTTAGG + Intergenic
1067343188 10:45420408-45420430 CAGAACAAATCATTTTTTTGAGG - Intronic
1069063363 10:63916939-63916961 CCAAACCAAGCAGTTTTTTGAGG - Intergenic
1069141439 10:64831425-64831447 CTGACACAGACATTCTTTTGAGG + Intergenic
1071841286 10:89474351-89474373 CTGAACCAGGCAGTGTGTTTGGG - Intronic
1071926512 10:90415700-90415722 CTCAAAAAGGCATTTTTTTAAGG - Intergenic
1074495726 10:113978664-113978686 CTGCACCAGGCATTTTCACGTGG + Intergenic
1075725021 10:124606663-124606685 CTGGGCCATGCACTTTTTTGGGG + Intronic
1076012806 10:127003962-127003984 CTGTACCTGGCCTTTTTTTTGGG - Intronic
1077072048 11:679553-679575 TTGAACCAGGCGTTTGTTGGTGG - Intronic
1078497403 11:11833068-11833090 CAGAACCAATCTTTTTTTTGAGG + Intergenic
1078508804 11:11970189-11970211 CTGAACCAGCCATATTTTGAGGG + Intronic
1082632580 11:55559492-55559514 AGGAACCAGCCATTCTTTTGTGG - Intergenic
1083704230 11:64502336-64502358 CAGAGCCAGGCATGTTTTAGTGG + Intergenic
1084706169 11:70817114-70817136 CTTCTCCAGGCATCTTTTTGAGG - Intronic
1088456695 11:110040279-110040301 CTGGACCAGGCATTGCTTTAAGG - Intergenic
1089052377 11:115557115-115557137 CTGAAACAGACATTTTGTTCTGG - Intergenic
1090000383 11:122951323-122951345 CTGAAGCAGTCATTTTGTGGTGG - Intronic
1091073615 11:132592726-132592748 CTGGACCACTCCTTTTTTTGGGG - Intronic
1091708368 12:2716712-2716734 CTGGACCAGTGATTTTTTTTAGG - Intergenic
1092566217 12:9668356-9668378 GGATACCAGGCATTTTTTTGGGG + Intronic
1093520017 12:20038557-20038579 CAGAACCAGGGCTTTTTTTCAGG - Intergenic
1094573322 12:31661275-31661297 CTGTAAGAGGCATTTTCTTGAGG + Intronic
1095411212 12:41925332-41925354 CTGAATCAGTCATTTTCTTTAGG - Intergenic
1095671110 12:44861266-44861288 CTGAGTCAGGCCTATTTTTGGGG - Intronic
1096541106 12:52307710-52307732 TTGAGCCAGGCATTGTTTTTAGG + Intronic
1098351084 12:69561440-69561462 CTGTACCAGGCATTTTATTAGGG - Intronic
1098972032 12:76867185-76867207 CAGAACCAGGCATTTTAAAGTGG - Intronic
1102203849 12:111076760-111076782 CTGCACTTGGCATTATTTTGGGG - Intronic
1102293010 12:111716213-111716235 CACACCCAGGCTTTTTTTTGGGG - Intronic
1102645163 12:114398956-114398978 CAGAACCCGCCACTTTTTTGTGG - Intronic
1103783195 12:123413203-123413225 CCGCACCCGGCTTTTTTTTGGGG - Exonic
1106295179 13:28406811-28406833 ATGAACCACTCATTTTTTTCTGG - Intronic
1106836300 13:33639005-33639027 GTGAACCAGACATTTTTCTAGGG + Intergenic
1109126089 13:58519115-58519137 CTGAACCCGCAATATTTTTGAGG + Intergenic
1109297191 13:60548350-60548372 CTGATCAAGGGATTTTTATGAGG + Intronic
1110074914 13:71228096-71228118 CTGAACCTGCCATCTCTTTGAGG + Intergenic
1110689948 13:78421258-78421280 CTGAACATGGGATTTTTTTCTGG - Intergenic
1111247148 13:85554628-85554650 CTGGAAGAGACATTTTTTTGTGG - Intergenic
1111622666 13:90744531-90744553 CAGAAGCAGGCATATTTTTAAGG - Intergenic
1114359947 14:21960424-21960446 ATGAAGCAGGCATTTTTCGGAGG - Intergenic
1115125980 14:29994226-29994248 CTAAACAAGTCATTTTATTGTGG + Intronic
1115747614 14:36453209-36453231 CTTGACTAGGCATTTTTGTGAGG - Intergenic
1116074526 14:40093406-40093428 TTGGACCAGGTATATTTTTGTGG + Intergenic
1116115869 14:40649957-40649979 CTGTACCAGGCATTTTATTAGGG - Intergenic
1116132461 14:40874008-40874030 CTGAACCTCTCATTATTTTGAGG + Intergenic
1119630123 14:76223009-76223031 CTGGACTGGGGATTTTTTTGTGG - Intronic
1120551285 14:85876290-85876312 CAGAATCATGCATTGTTTTGAGG - Intergenic
1202918755 14_KI270723v1_random:11762-11784 CTGAACCAGTAATATTTATGGGG - Intergenic
1202925881 14_KI270724v1_random:23292-23314 CTGAACCAGTAATATTTATGGGG + Intergenic
1124136206 15:27038398-27038420 CAAACCCAGGCATTCTTTTGAGG + Intronic
1126452356 15:48822484-48822506 CTGAGCCTGGAATTTCTTTGGGG + Intergenic
1126708045 15:51425315-51425337 CTTAACCAGTCATTTTATTCTGG + Intergenic
1127509105 15:59622719-59622741 GTGAACTTGTCATTTTTTTGGGG + Exonic
1130529725 15:84737268-84737290 CTGAACCAGGCATTATGCTAGGG + Intergenic
1132911111 16:2312374-2312396 CTGAACCATGGATTATCTTGAGG - Intronic
1135960351 16:26989838-26989860 ATGAAGCAAGCATTTTTTGGAGG - Intergenic
1137499545 16:48999840-48999862 CTGTGCCAGGCATTTTTCTAGGG + Intergenic
1138807420 16:60107283-60107305 TTGAACAAGGCAGTTTATTGGGG + Intergenic
1139524240 16:67503857-67503879 GGGACCCAGGCATTTTTGTGAGG + Intergenic
1140169932 16:72594051-72594073 TTGACACTGGCATTTTTTTGTGG + Intergenic
1140778197 16:78269935-78269957 TTTCACCAGGTATTTTTTTGTGG + Intronic
1144052817 17:11511575-11511597 CTGAACCAGGCATTTTTTTGGGG - Intronic
1144287745 17:13794760-13794782 TTGAACCAGGGATTCTTTTTGGG + Intergenic
1144702586 17:17348782-17348804 CTGAACCAGGAATATATTTGGGG + Intergenic
1146974044 17:37096006-37096028 ATGAAGCTGGCATTTTCTTGGGG - Intronic
1148416637 17:47511700-47511722 CTGATCCAGGCCATTTTATGTGG - Intergenic
1149828085 17:59847903-59847925 TTGTACCAGGCATTATTTTCAGG + Intergenic
1151044523 17:70903826-70903848 CCGCACCTGGCCTTTTTTTGGGG + Intergenic
1152762887 17:82118628-82118650 CAGAAGCAGGTATTTCTTTGGGG + Intronic
1154973067 18:21429641-21429663 CTGAACTAGGCTTTTCTTTGTGG + Intronic
1157010105 18:43637374-43637396 CTGAACCAGCAATATATTTGAGG - Intergenic
1157070593 18:44403542-44403564 CTGAACCAGTCAATATTTAGAGG + Intergenic
1160574190 18:79840784-79840806 GTTAATCAGGAATTTTTTTGTGG - Intergenic
1160595231 18:79968832-79968854 CTGATCCTAGCATTCTTTTGTGG - Intronic
1161926753 19:7306489-7306511 ATGTACCAAGCATTTTTTTATGG - Intergenic
1164866472 19:31608403-31608425 CAGAACCATGCACTTTTTGGTGG - Intergenic
1165588819 19:36947313-36947335 CTGAACCTGGAAGTTTTGTGTGG + Intronic
925870802 2:8268595-8268617 GTGAACAAGGCAATTTTCTGTGG + Intergenic
926024411 2:9528658-9528680 CAGAACCAGGCAGTTTGTGGGGG + Intronic
926475069 2:13311596-13311618 CTGGACCTGGGTTTTTTTTGTGG + Intergenic
927290051 2:21396289-21396311 CTGCTCCAGGCATCTTCTTGAGG - Intergenic
928176057 2:29035173-29035195 GTGTACCAGTCATTCTTTTGTGG + Intronic
929028989 2:37633481-37633503 CTGGAACAGGCACTTTTGTGAGG - Intergenic
931266684 2:60666747-60666769 CCGAACCAGCCATTTTTTTCAGG + Intergenic
931726204 2:65113348-65113370 CTGCACCAGGCTTTTTTTAAAGG - Intronic
932046274 2:68353410-68353432 CTGAACTAGCCACTTTTTTGTGG + Intergenic
932281901 2:70500394-70500416 CTGAACCAGGATGTTGTTTGGGG - Intronic
935167556 2:100582446-100582468 CCGCACCCGGCCTTTTTTTGGGG - Intergenic
935723727 2:106003310-106003332 CTGGACCTGGGCTTTTTTTGTGG + Intergenic
935782365 2:106519435-106519457 CTGAACCAGGCCCTGTATTGAGG + Intergenic
935799837 2:106684114-106684136 CTGAGCCTGGAAATTTTTTGGGG + Intergenic
939588734 2:144036799-144036821 TTGCAACAGGAATTTTTTTGGGG + Intronic
940338523 2:152554826-152554848 CTGAACTAGCCATTTTTTCATGG - Intronic
940943514 2:159590297-159590319 CTGTACCTGGCCTATTTTTGAGG - Intronic
941608790 2:167634720-167634742 CTGGACCTGGGATTTTTTTTTGG - Intergenic
942593442 2:177569799-177569821 TTGAACTAGTCATTTTTTAGAGG - Intergenic
945263102 2:207863119-207863141 CTGAGCCATGCATTTCTTCGAGG + Intronic
945520627 2:210823023-210823045 ATGAATCAGGCCTTTTCTTGGGG + Intergenic
945598576 2:211828675-211828697 CTGAACCAGACATTTCTGTGGGG - Intronic
945720830 2:213416610-213416632 ATGAACAAGGCATTTCATTGAGG + Intronic
947266449 2:228287544-228287566 CTGGTCCAGGTATTTTTTTTTGG + Intergenic
948241684 2:236442959-236442981 CTGAACCAGCCATTTCTTAATGG - Intronic
1168751535 20:285325-285347 CTGAAGCAGGGATTTTGGTGAGG - Intronic
1171144671 20:22771256-22771278 CTATACCAAGCATTTTTTTAAGG + Intergenic
1171782727 20:29436061-29436083 CTGAACCAGTAATATTTATGGGG - Intergenic
1176965676 21:15209069-15209091 CTGGACCATGCACTTTTTTAGGG + Intergenic
1178618855 21:34157004-34157026 CTGAGCCAGGAGTTGTTTTGAGG + Intergenic
1178778433 21:35575386-35575408 CTGAACCAGGCTTTCTGTTGTGG - Intronic
1179779881 21:43692859-43692881 GTGAACCAGGCATTTGTGTCTGG - Intronic
1180016924 21:45093210-45093232 CTGATCCAGGCACTTTGCTGGGG + Intronic
1181893612 22:26086568-26086590 GTGAACCAAGGATGTTTTTGTGG + Intergenic
1183874395 22:40766687-40766709 CTCAATCAGCCACTTTTTTGTGG + Intergenic
1184336368 22:43855510-43855532 CTAAACCAGTCATTTTGTGGGGG - Intronic
1185273750 22:49941076-49941098 CTGAAGCAGCCTTTTTTCTGGGG - Intergenic
949838415 3:8293821-8293843 CTGTGCCAGGCATTGTTCTGGGG - Intergenic
950969171 3:17169250-17169272 ATGCACCAGGCATTATTCTGAGG - Intronic
951270068 3:20614091-20614113 CTGAACAAGGGATGTTTTTTAGG - Intergenic
952389318 3:32866224-32866246 CTGCACCAGGCCTTTTTGTTTGG + Intronic
956263117 3:67366818-67366840 TTTAACCAGCCATGTTTTTGAGG + Intronic
957568423 3:81914640-81914662 CTTACCCATACATTTTTTTGGGG - Intergenic
957708975 3:83828835-83828857 CTAAACCATGCATTTTTTTTTGG + Intergenic
959689348 3:109181741-109181763 CTGAACCAAGGATTCTTTTCGGG - Intergenic
960535683 3:118812417-118812439 TTTAAACAGGCATTATTTTGGGG - Intergenic
963072290 3:141314209-141314231 CTGAACTAGACCTTTTTTTCTGG + Intergenic
963298394 3:143572881-143572903 CTGAACCAGGCAGTTGCCTGGGG + Intronic
964199836 3:154106662-154106684 CTGAACCAGGCTTTTTTTTGTGG - Intergenic
965391021 3:168103712-168103734 CTGAACAAGAAATTTGTTTGAGG + Intergenic
965430508 3:168581860-168581882 CTGAGCCAGGCATCTTGCTGTGG + Intergenic
967597991 3:191350466-191350488 TTAATCCAGGCATTTTTATGTGG + Intronic
970857217 4:20662737-20662759 ATGTACCAGGCATATTTTGGGGG - Intergenic
971023325 4:22562051-22562073 CTGAATTAGGGATTTTTTGGGGG + Intergenic
971224010 4:24734767-24734789 AAGAACCATGCATTTTCTTGAGG + Intergenic
972522642 4:39874602-39874624 CTGAAGTAGGCTTTTTCTTGAGG - Intronic
973206748 4:47569545-47569567 TTGTACCAGGCATTTTTCTAAGG + Intronic
974495030 4:62615258-62615280 CTGAAAAACCCATTTTTTTGAGG - Intergenic
974698330 4:65403985-65404007 CTGTACCAAGTATATTTTTGAGG - Intronic
975354050 4:73379033-73379055 TTGAACCAGCCATTTTTGTTTGG - Intergenic
976807581 4:89065277-89065299 ATGAACCAATCAATTTTTTGTGG - Intronic
977908718 4:102506601-102506623 TTGAACCATTTATTTTTTTGTGG + Intronic
980169534 4:129272399-129272421 TGTAACCAGGCATTTTGTTGTGG - Intergenic
981498980 4:145426399-145426421 CTGAAGCAGGCAGATTTTTGAGG + Intergenic
981838085 4:149078888-149078910 CTGAATCAGCCATTTTTCTGAGG + Intergenic
984362379 4:178751868-178751890 CAGAACCATGCATTTATTTAAGG + Intergenic
984453838 4:179939696-179939718 CAGAATCTGACATTTTTTTGAGG - Intergenic
984660992 4:182375322-182375344 TTTAACCAGGCATCTATTTGGGG - Intronic
986858594 5:11902352-11902374 GTGAACCTGTCATTATTTTGGGG - Intronic
988261836 5:28896284-28896306 ATCATCCAGGTATTTTTTTGGGG + Intergenic
989105025 5:37854879-37854901 TTGAACAAGTCTTTTTTTTGTGG + Intergenic
989590144 5:43105266-43105288 CTCATGCAGGCTTTTTTTTGGGG - Intronic
989980170 5:50633885-50633907 CTGAAACAGGCGATTTTTAGGGG + Intergenic
993686139 5:90940547-90940569 TTGTACCAGGTATTTTTTTCAGG + Intronic
994358713 5:98825628-98825650 ATGAACCAGGCAGTATTTTGTGG - Intergenic
994713533 5:103295295-103295317 CTGTAACAGGAATTTTTTTATGG - Intergenic
995211870 5:109549968-109549990 CTGGGCCTGGTATTTTTTTGAGG - Intergenic
995566631 5:113437798-113437820 CTGACCAAGGCATTTTATTATGG + Intronic
996330659 5:122324994-122325016 CTGAGCCAGGCCTTGTTCTGAGG - Intronic
996571128 5:124933293-124933315 CTGAGCCAGGCAGTTGTTTAAGG - Intergenic
998133533 5:139662982-139663004 CTAGACCTGGCATTTTTCTGGGG + Intronic
999373802 5:151072474-151072496 CTGCCCCAGGAATTGTTTTGGGG - Intronic
999849080 5:155517851-155517873 CTGGCCCAGGTATATTTTTGAGG + Intergenic
1000810143 5:165851358-165851380 CTGTGCCAGGCATTGTTTAGGGG + Intergenic
1001869938 5:175144028-175144050 TTGACCCTTGCATTTTTTTGGGG - Intergenic
1001893433 5:175358672-175358694 ATGTACCAGGCAGTTTTCTGGGG - Intergenic
1002413075 5:179099389-179099411 CTGGCCCAGGCTTTTCTTTGTGG - Intergenic
1003702028 6:8477116-8477138 CTGATCCTGGAATTTTTTTGAGG + Intergenic
1003840871 6:10118091-10118113 CTGGACCAGGTATTTTTAGGAGG - Intronic
1004315167 6:14580553-14580575 CTGAACCACCCCTTTTTTTATGG + Intergenic
1004339853 6:14798631-14798653 CTGACCCATCCATTTGTTTGTGG - Intergenic
1004761440 6:18670988-18671010 CTGAGCCAAGCATTATGTTGTGG + Intergenic
1006375040 6:33667367-33667389 CTGTGCCAGGCACTGTTTTGGGG + Intronic
1008176642 6:48276119-48276141 CTGAAGCATGCATTTACTTGTGG - Intergenic
1013691128 6:112645607-112645629 CTGACCCAGGCATGATTTCGTGG - Intergenic
1015307937 6:131731333-131731355 GAGAACCAGCCATTTTGTTGAGG + Intronic
1015581353 6:134729018-134729040 CTGCACCGGGCCTTTTTTTCTGG - Intergenic
1016223314 6:141703464-141703486 CTGAGCCTGGCCTTTTTGTGAGG - Intergenic
1019369738 7:655415-655437 GTGAACCAGGAATTTATCTGGGG - Intronic
1024149740 7:46558912-46558934 CTGAAAGAGGCATATTTGTGTGG - Intergenic
1024685495 7:51740382-51740404 CTGCACTTGGCATATTTTTGAGG - Intergenic
1027532879 7:79357317-79357339 CTGAACCAGGCATCTTATGCAGG + Intronic
1027824655 7:83095085-83095107 CTGGACCTGGAATTTTTTTGTGG + Intronic
1030015359 7:105214214-105214236 CTGCTCTAGGCATTTTTTTAAGG + Intronic
1030351049 7:108488100-108488122 TTTAAACAGGCATTTCTTTGTGG + Intronic
1033880166 7:145871525-145871547 CTGTATCAGTCATTTATTTGTGG + Intergenic
1034074249 7:148216550-148216572 CTGTACCAGGGATTTATTTTTGG + Intronic
1035196932 7:157229605-157229627 CTGCACCCGGCCTGTTTTTGGGG + Intronic
1035518695 8:258581-258603 ATGGACCAGGCAATTTTCTGTGG - Intergenic
1036984761 8:13516149-13516171 ATGACTCAAGCATTTTTTTGGGG + Intergenic
1037269476 8:17110717-17110739 CTGTACCTGGCAATTTTTTTGGG + Intronic
1037998454 8:23370060-23370082 CTGAACCAGGACTTTTTATATGG - Intronic
1038631599 8:29250239-29250261 ATGAACCACCCATTTTTTTCAGG - Intronic
1041763125 8:61388307-61388329 CTGAATCAATCATTTTTTTTTGG + Intronic
1042419309 8:68566660-68566682 CTGAACCAGGCATTGGCTTCAGG + Intronic
1042765658 8:72318707-72318729 CTGAAGTGGGCATTTTTTTCTGG - Intergenic
1043860918 8:85316281-85316303 CTGAACAAGGCAAGGTTTTGTGG - Intergenic
1044002163 8:86896417-86896439 CTGATCCAGGGATGTCTTTGGGG + Intronic
1044395538 8:91706453-91706475 ATGGACCTGGCATTTGTTTGGGG - Intergenic
1045728245 8:105201398-105201420 CTGAACCTGGGCTTTTTTTTGGG - Intronic
1045889441 8:107136986-107137008 CTGAACCAGTCATATCTCTGAGG - Intergenic
1045958712 8:107941089-107941111 GTGAACTATACATTTTTTTGGGG - Intronic
1046126517 8:109915955-109915977 CTGTGCCAGGCTCTTTTTTGTGG - Intergenic
1047276922 8:123412876-123412898 CTTAAGCAGGCATTTTAATGGGG - Intronic
1047550888 8:125871175-125871197 TTGAACCCTGCATTTTTCTGAGG + Intergenic
1047758960 8:127939968-127939990 CTGAACCCTGCATTTTGTGGAGG + Intergenic
1049946003 9:596457-596479 CTGAACTAGGCTTTTGTTTCTGG + Intronic
1050244278 9:3671722-3671744 CAGAATCAGGGATTTTGTTGTGG - Intergenic
1053897246 9:42754383-42754405 CTGGGCCTGGAATTTTTTTGTGG - Intergenic
1057102865 9:92379796-92379818 CCGAAGCCTGCATTTTTTTGTGG + Exonic
1058608800 9:106752833-106752855 CTGAAGCAGGGATTATTCTGGGG + Intergenic
1058833704 9:108841905-108841927 ATGAACCATGCAACTTTTTGGGG - Intergenic
1059085008 9:111291472-111291494 CTAAACCTGGCTTTGTTTTGAGG + Intergenic
1060141531 9:121214485-121214507 ATGAACCAGGCCTTGTTTTGTGG - Intronic
1186046653 X:5544067-5544089 CTGTCACAGACATTTTTTTGGGG + Intergenic
1187518917 X:19996454-19996476 ATGATATAGGCATTTTTTTGTGG + Intergenic
1188887402 X:35567838-35567860 CTGAAACATGCATTTTCTTTTGG - Intergenic
1190276456 X:48902586-48902608 CAGGTCCAGGCATCTTTTTGAGG - Intronic
1190780201 X:53586705-53586727 CTGAATCAGGCACTCTTCTGGGG - Intronic
1192466589 X:71361183-71361205 CTGAATGAGGCATCTTTTTGGGG - Intergenic
1194813891 X:98418881-98418903 CTGAAGAAGGAACTTTTTTGAGG - Intergenic
1197248483 X:124190477-124190499 CAGACTCAGGCATTTCTTTGTGG + Intronic
1201724647 Y:17139170-17139192 GTAAAAAAGGCATTTTTTTGAGG + Intergenic