ID: 1144052826

View in Genome Browser
Species Human (GRCh38)
Location 17:11511749-11511771
Sequence CTTTGCACACAGAAGGAACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144052826_1144052828 -9 Left 1144052826 17:11511749-11511771 CCACGTTCCTTCTGTGTGCAAAG 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1144052828 17:11511763-11511785 TGTGCAAAGCACTATGCAGCTGG 0: 1
1: 0
2: 2
3: 19
4: 143
1144052826_1144052830 9 Left 1144052826 17:11511749-11511771 CCACGTTCCTTCTGTGTGCAAAG 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1144052830 17:11511781-11511803 GCTGGTGAAGGAGATAAACAAGG 0: 1
1: 0
2: 5
3: 42
4: 330
1144052826_1144052829 -3 Left 1144052826 17:11511749-11511771 CCACGTTCCTTCTGTGTGCAAAG 0: 1
1: 0
2: 1
3: 17
4: 152
Right 1144052829 17:11511769-11511791 AAGCACTATGCAGCTGGTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144052826 Original CRISPR CTTTGCACACAGAAGGAACG TGG (reversed) Intronic
901050407 1:6423437-6423459 GTTTGCAGACAAAAGGAAGGAGG - Intronic
903322485 1:22551371-22551393 CCTGGCACACAGCAGGCACGGGG - Intergenic
904754112 1:32758677-32758699 CTTTGCCCCTAGAAGGAAGGGGG - Intronic
905120436 1:35677734-35677756 CTATGCACACAGAACGGACAAGG - Intergenic
909738692 1:79000470-79000492 CTTTGAAAAGAGAAGGAAAGGGG - Intronic
912398145 1:109364940-109364962 CATTGCAAACAGAATGAACTTGG - Intronic
921315236 1:213884265-213884287 CTTTGCAGATTGAAGGAAGGGGG - Intergenic
921386076 1:214571264-214571286 CTTTGCACAGTGAAGGGATGAGG + Intergenic
923458174 1:234184570-234184592 TTTTTCTCATAGAAGGAACGTGG + Intronic
923898062 1:238294688-238294710 CATTGTACACTGAAGGAACCAGG + Intergenic
1063454861 10:6175946-6175968 ATCTGCACACAGAAGGATCCAGG + Intronic
1063693534 10:8310293-8310315 CATTGCAGCCAGAAAGAACGAGG - Intergenic
1063879225 10:10513823-10513845 CTTTGCATAGAGAGGGAACCAGG - Intergenic
1063879239 10:10513938-10513960 CTTTGCTCAGAGAGGGATCGAGG - Intergenic
1064142047 10:12798843-12798865 CTGTGCACACAGAAGAATCAGGG + Intronic
1069290883 10:66778335-66778357 CTTTGAAAAAAGAAGGAATGAGG - Intronic
1069559915 10:69422151-69422173 TATTGCAGACAGAAGGAACTTGG + Intergenic
1070525217 10:77290489-77290511 CTTTTCACACATAAGGAAAGTGG - Intronic
1072271034 10:93776845-93776867 CTTTGCACACAGACTGAAAATGG - Intronic
1073248293 10:102106852-102106874 CCTTCCTCACAGAAGGAAGGAGG - Intergenic
1078329236 11:10405825-10405847 CTTGGCACACAGAGGGAAAGGGG - Intronic
1078338956 11:10485546-10485568 CTATGCACGCAGAAGGGACAGGG - Intronic
1081187490 11:40062564-40062586 CTTTGCACACAGGAGTATCTTGG - Intergenic
1083057486 11:59836933-59836955 CTTTGCACATAGTAGGAGCTAGG + Intronic
1083747942 11:64745507-64745529 CAGTTCACACAGGAGGAACGGGG + Intergenic
1085143095 11:74167014-74167036 ATTTGCACAAAGAAGCAACCCGG - Intronic
1085741591 11:79082162-79082184 CTTTGCACCTAGAAGGACCATGG - Intronic
1085751702 11:79167816-79167838 CTGTGGACACAGAAGGAGCCTGG - Intronic
1085984693 11:81771225-81771247 CTTGGCACAAAGAAGGATCTTGG + Intergenic
1090234161 11:125134145-125134167 TTTTGCACACTGAAGCAAAGGGG + Intergenic
1090269315 11:125374811-125374833 CTTGGCACACAGAAGGCTCTTGG + Intronic
1093505076 12:19855676-19855698 CTTTTTACCCAGAAGGAAAGTGG - Intergenic
1093623157 12:21316160-21316182 CTTCTCAAACTGAAGGAACGTGG - Intronic
1095455176 12:42375877-42375899 CCTTGCACATAGAAGGCACAAGG - Intronic
1097190313 12:57216548-57216570 CTGTGCGCCCAGGAGGAACGGGG - Intergenic
1097415355 12:59308979-59309001 CTTTGCACATAGAGGGATCAAGG + Intergenic
1098314621 12:69180392-69180414 CCTGGCACACAGAAGGCACTCGG + Intergenic
1100218555 12:92479292-92479314 CTTTGCAAACAGATGGAATTTGG - Intergenic
1100580245 12:95932116-95932138 CTTTGAACAGAGAAGGAATGTGG + Intronic
1103837042 12:123829913-123829935 CTGTGCACACAGACACAACGGGG - Intronic
1107326867 13:39253608-39253630 CTTAGCACACAGTAGGAACTTGG + Intergenic
1110001344 13:70206060-70206082 CATTCTACACAGAAGGAAAGTGG - Intergenic
1111897368 13:94157890-94157912 ATGTGCACACAGCAGGAAAGGGG + Intronic
1120500693 14:85293858-85293880 TTTTTCACACCAAAGGAACGCGG + Intergenic
1121865514 14:97359131-97359153 CTTTGTACCCAGAAGGACCTGGG - Intergenic
1122778637 14:104134374-104134396 CCCTGCACACTGAAGGGACGTGG + Intergenic
1124452314 15:29806526-29806548 CTTTGCTCACAGAAGGAACTTGG - Intronic
1125450123 15:39799403-39799425 GTTTGCTCACAGCAGAAACGGGG - Intronic
1127581770 15:60345381-60345403 CTTTGCAAAGAGAAGGAAAAGGG - Intergenic
1129913496 15:79247420-79247442 CTCAGCAAACAGAAGGAACCAGG - Intergenic
1130043501 15:80426261-80426283 CTTTGGTCACAGAAGGAGCTAGG - Intronic
1134234933 16:12458196-12458218 CTGGGCTCACAGATGGAACGTGG - Intronic
1135264389 16:21010139-21010161 CTGGGCACACAGAAGGCACTTGG + Intronic
1136505861 16:30702644-30702666 CATTGCACTCAGAAGGAAGGAGG - Intronic
1140716773 16:77733757-77733779 CATTGCACACAGTTGGAAAGAGG + Intronic
1140782624 16:78310573-78310595 CTTTGCATGCAGAAGCACCGGGG - Intronic
1141663203 16:85452810-85452832 GTTTGTTCACAGAACGAACGGGG - Intergenic
1142472000 17:169851-169873 ATTTACACAGAGAAGGAACTGGG + Intronic
1144052826 17:11511749-11511771 CTTTGCACACAGAAGGAACGTGG - Intronic
1146393096 17:32440915-32440937 CTTTGAAGTGAGAAGGAACGTGG + Intergenic
1147243207 17:39104369-39104391 CTTTGCATATAGAAGGTACTGGG + Intronic
1150333339 17:64312053-64312075 CTTTGCACACAGCAGGATCATGG - Intergenic
1155401421 18:25443529-25443551 ACTTGCACAAAGAAGGAAGGAGG + Intergenic
1155481031 18:26287812-26287834 CTTTGGACATAGAATGAAAGGGG + Intronic
1160331942 18:78001700-78001722 CATTGCACACAGAACACACGAGG - Intergenic
1160938930 19:1610896-1610918 CACTGCACACAGACAGAACGGGG - Exonic
1161719707 19:5896046-5896068 CAAGGCACACAGAAGGAAGGCGG + Intronic
1164801055 19:31077070-31077092 ATTTGCACAACGAAGGAATGGGG - Intergenic
1166251357 19:41573108-41573130 CTTTGCACAAGGAAGGGACCCGG - Intronic
1168065274 19:53915629-53915651 CATTGCACATAGAAGGAAAGTGG - Intronic
925242856 2:2347772-2347794 CTTTGCTCACAGAACCAATGAGG + Intergenic
925583707 2:5441092-5441114 CTTTGCAAACAGAATCAACAGGG + Intergenic
926238748 2:11069182-11069204 CTTGGCACAGAGAAGGAAGCGGG - Intergenic
927939199 2:27093116-27093138 CTTTGCACACTGTGGGCACGGGG + Intronic
928334713 2:30386829-30386851 CCATGCACATAGAAGGAACTGGG + Intergenic
929452358 2:42046566-42046588 CTTTGGACATGGAAGGACCGAGG - Intergenic
930963574 2:57291330-57291352 CTTAGGACACAGAAAGAAAGTGG - Intergenic
931178069 2:59873337-59873359 CTTTGTTCACAGAAGGAATCAGG + Intergenic
934515632 2:94984846-94984868 CATTGCCCACAGAGGGAACCCGG - Intergenic
934528010 2:95063837-95063859 CTGTGCACACAGCAGGAAAGGGG - Intergenic
937043694 2:118839435-118839457 CTTTGCCCTCAGAAAGAACCAGG + Intergenic
941005687 2:160244853-160244875 GTCTGCAGACAGAAGGAAGGAGG + Intronic
942003202 2:171671400-171671422 CTTTGAAGATAGAAGGAACACGG + Intergenic
944233450 2:197419271-197419293 TGATGCACACAGAAGCAACGTGG + Intronic
944948149 2:204714566-204714588 CTTTCCACAAAGAAAGAAGGAGG + Intronic
945160247 2:206883126-206883148 CTCTGCACTCAAAAGGAAGGAGG + Intergenic
945444302 2:209917780-209917802 CACTGCACACAGCAGGAACATGG - Exonic
945986245 2:216356113-216356135 CTTCGCACACTGAAGGAATGTGG - Intronic
947925544 2:233918993-233919015 CTTTGCACACTGAATGAGAGAGG - Intronic
948543569 2:238708004-238708026 CTATGCAAACAGAAAGAAAGTGG - Intergenic
1169142192 20:3232975-3232997 ATTTGCACACAGAAGGCCAGGGG + Intronic
1169623091 20:7529937-7529959 CTTTGCACCCTAAAGGAACCAGG + Intergenic
1170805298 20:19624616-19624638 CTTTGGACACTGAAGGAGAGTGG - Intronic
1172115160 20:32569363-32569385 TTTTGAACAGAGAAGGAACATGG + Intronic
1173326392 20:42037454-42037476 GTTTGCACAGAGCAGGAAAGGGG - Intergenic
1175165150 20:57038322-57038344 CTTGGCACACAGTAGGAGCTCGG - Intergenic
1175383947 20:58582286-58582308 CTTTGCAAACAAAAGCAACCTGG - Intergenic
1179422864 21:41249996-41250018 CCTTGCACACAGAAGAGACCTGG - Intronic
1180798664 22:18620903-18620925 CTTTGCACTCAGAAGGGTCCAGG + Intergenic
1181433758 22:22898586-22898608 CTTTGCACACAGATGATCCGGGG + Intergenic
1181434699 22:22903955-22903977 CTTTGCACACAGAAGATCCGGGG + Intergenic
1182107209 22:27698098-27698120 CTGTCCACACAGAAGTCACGAGG + Intergenic
1182283817 22:29232477-29232499 GCTGGCACACAGAAGGCACGTGG - Intronic
1183951353 22:41354783-41354805 CGTAGGACAGAGAAGGAACGTGG + Intronic
1184513406 22:44946004-44946026 CTTGGCACACTGTAGGAACTTGG - Intronic
1184822556 22:46920620-46920642 CTTTGCACAGAGAAGCTTCGTGG + Intronic
952692667 3:36228060-36228082 CTTTGCACACAGATTAAAAGCGG - Intergenic
954784820 3:53085050-53085072 CTTTGCACTCAGAAGCAAGGAGG + Intronic
957543612 3:81608280-81608302 CTTTGCACAAGGAAAGAAAGGGG + Intronic
957652108 3:83021044-83021066 CTTTGCACTCTGAATGAAAGGGG - Intergenic
958997932 3:100927301-100927323 CTTTGGAGCCAGAAGGAACCAGG + Intronic
959794890 3:110414313-110414335 CTTGGCACTCAGAAGGAAACAGG - Intergenic
963916427 3:150862725-150862747 CTTTCCACACAGATGGACTGAGG - Intergenic
969069045 4:4517422-4517444 GTTTTCACACAGAAGGAAAAGGG + Intronic
969354468 4:6617357-6617379 CTTTGGGGACAGAAGGAAGGTGG - Intronic
969885990 4:10215944-10215966 CTTAGCACAGAAAAGGAACCTGG + Intergenic
970500475 4:16671868-16671890 CTTTCCACACAGAATGAAAGTGG + Intronic
970744072 4:19274241-19274263 TTTTGCACACAGATGGGACAAGG + Intergenic
971358450 4:25914996-25915018 CTTTCCACTCAGAAGGATCAGGG - Intronic
975350196 4:73337717-73337739 CTTTGCACACAGAAGCACAGGGG - Intergenic
975579048 4:75890699-75890721 ATTTGCAAGCAGAAGGAAAGGGG + Intronic
976610812 4:87028692-87028714 CTTCTCACACTGAAGGAAAGTGG + Intronic
978249690 4:106615564-106615586 CTTTGTAAACAGAAGAAAAGAGG + Intergenic
979280819 4:118865688-118865710 CTTTGGAAACAGGAGGAAGGAGG + Intronic
981532595 4:145766505-145766527 CATTGCAGAGAGAAGGAACCAGG + Intronic
981602479 4:146506115-146506137 TTTTGCACATAGAAGGGAAGGGG - Intronic
981963612 4:150573878-150573900 CTTTTAACACAGTAGGAACTTGG + Intronic
984456485 4:179975801-179975823 TTTTGGAAACAGAAGGAAGGGGG - Intergenic
985278140 4:188258828-188258850 CTTTGCACACAGAATAATCAAGG - Intergenic
986262534 5:6160769-6160791 CTTTTAAAACAGAAGGAAAGTGG + Intergenic
987155128 5:15081552-15081574 ATTTGCACCCAGAAGGAGCCTGG - Intergenic
987326842 5:16820107-16820129 CTTCGCACCCAGAAGGCACAAGG + Intronic
987746405 5:21978975-21978997 ATTTGCACAAAGAAGGAAGGAGG + Intronic
991766613 5:69989045-69989067 ATTTGCACAAAGAAGGAAGGAGG + Intergenic
991845844 5:70864132-70864154 ATTTGCACAAAGAAGGAAGGAGG + Intergenic
992698595 5:79316115-79316137 CTTGGCACAAATAAGGAAAGGGG + Exonic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
997659130 5:135576684-135576706 CCTTGCACCCAGAAGGATCCAGG - Intronic
999245570 5:150152720-150152742 CTCTGCCCACAGAAGGGACCTGG - Intronic
1000076375 5:157791427-157791449 CTTTGCACAGAGGAGGAACATGG - Intronic
1002849461 6:980652-980674 TTTTGCACATAGAAGGGACCTGG - Intergenic
1006637676 6:35472211-35472233 CTTTGCAATCAGAAGGAAAAGGG + Intergenic
1015392400 6:132697252-132697274 CTTTGAAGACAGAAGCAACCTGG + Intronic
1015841062 6:137477849-137477871 CATTGCACAGAGAAGGAAACAGG + Intergenic
1016619340 6:146090114-146090136 CTTCACACACAGAAGGTACATGG - Intronic
1016910537 6:149194360-149194382 TTTTGCACACAGAGCAAACGGGG - Intergenic
1022141002 7:27492635-27492657 AGTTGGACACAGAAGAAACGAGG - Intergenic
1023178559 7:37457617-37457639 CTTGGCAAACAGCAGGAAAGTGG - Intergenic
1023389182 7:39691557-39691579 ATTTTCACACATAAGGAAAGAGG + Intronic
1024266855 7:47613298-47613320 CTTTGCAAAAAGAAAGAAAGAGG - Intergenic
1024524734 7:50338406-50338428 CTTTCAACACAGATGGAACAAGG - Intronic
1035015531 7:155762630-155762652 CTCTGCAAAAAGAAGGAACATGG - Intronic
1035395436 7:158531783-158531805 CTCTGCTCATAGAAAGAACGTGG + Intronic
1035738452 8:1907015-1907037 TTCTGCACACAGAAGGCAGGTGG - Intronic
1043194059 8:77268083-77268105 TTTTGCACACAGAAGAAAATTGG - Intergenic
1045146463 8:99350145-99350167 CTTTTCAAACAGAATGAAGGGGG + Intronic
1045653340 8:104363180-104363202 CATTGGACACAGAAAGAAGGCGG - Intronic
1047646442 8:126875231-126875253 CCTTTCCCACAGCAGGAACGGGG + Intergenic
1049862532 8:144909873-144909895 CTCTGCACACAGAAGCCACATGG + Intergenic
1053777430 9:41561514-41561536 CTTGGCACAAAGAAAAAACGTGG + Intergenic
1056983114 9:91335200-91335222 CTTTCCACACAGAAAGCACCGGG - Intronic
1057515366 9:95715913-95715935 ATTTTCACAAAGAAGGAACTCGG + Intergenic
1060746859 9:126142340-126142362 AATTGAACACAGAAGGAAAGAGG - Intergenic
1060858029 9:126931072-126931094 CTTTGGACTTAGAAGGAACCTGG - Intronic
1060907729 9:127322770-127322792 CTTTCCACAAAGAGGGAAGGTGG + Intronic
1062466005 9:136681927-136681949 CTTTGCACACAGGAGGTGCAGGG - Intronic
1187311318 X:18146152-18146174 CTTTGCACCCAAAAGGAAAAGGG - Intergenic
1190107827 X:47572147-47572169 CTTTGCACACGGAAGGCCAGTGG - Exonic
1197635828 X:128913953-128913975 ATTTGCACAGAGAAAGAAGGTGG + Intergenic
1198432796 X:136584629-136584651 GTTTGGACACAGAAAGAACAGGG - Intergenic
1199903790 X:152204383-152204405 CTTTGCATCTAGAAGGAAGGAGG - Intronic