ID: 1144053005

View in Genome Browser
Species Human (GRCh38)
Location 17:11514124-11514146
Sequence CACCCTCTCCTCTTCGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 150}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144053000_1144053005 19 Left 1144053000 17:11514082-11514104 CCTAGGGAGAGGCAGTTCTGACT 0: 1
1: 0
2: 1
3: 26
4: 249
Right 1144053005 17:11514124-11514146 CACCCTCTCCTCTTCGTGGACGG 0: 1
1: 0
2: 0
3: 14
4: 150
1144052998_1144053005 30 Left 1144052998 17:11514071-11514093 CCTAGACAGTGCCTAGGGAGAGG 0: 1
1: 0
2: 3
3: 22
4: 206
Right 1144053005 17:11514124-11514146 CACCCTCTCCTCTTCGTGGACGG 0: 1
1: 0
2: 0
3: 14
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144053005 Original CRISPR CACCCTCTCCTCTTCGTGGA CGG Intronic
901647383 1:10723915-10723937 CACCTTCTCCTCTTCTTTGGGGG + Intronic
902137807 1:14325916-14325938 CCCCCTCTCCTCTTAGTGGCGGG + Intergenic
902261278 1:15226597-15226619 CATCCACTCCTCTTCATGGTGGG - Intergenic
902569223 1:17336128-17336150 CAACCTCTCCTCTTACTTGATGG + Intronic
903324022 1:22559407-22559429 CTCCCTCTCCTCTGGCTGGAAGG - Intergenic
903974511 1:27140473-27140495 CACCCTCACCTCTTCCTTTAAGG + Intronic
905445977 1:38028750-38028772 CACCCCCTCCTCTTGCTGGCTGG + Intergenic
905488549 1:38325448-38325470 CCTCATCTCCTCTTCTTGGAAGG + Intergenic
905632996 1:39529357-39529379 CACACTCGCCTGCTCGTGGAAGG + Intergenic
905770830 1:40636925-40636947 CACCCTCTCCTCCTGGCGGGGGG + Intronic
906484252 1:46222118-46222140 CTCCCTCTCCTTTTCCAGGATGG - Intergenic
906606389 1:47175336-47175358 CACCCTCAGCTCTTGGAGGACGG - Intergenic
909293689 1:73916247-73916269 TAGCCTCTCCTCTTCAAGGAGGG + Intergenic
913070620 1:115295178-115295200 CTCCAACTCCTCTTCGTGGTTGG - Intronic
913250870 1:116910754-116910776 CACCCTGTGACCTTCGTGGAAGG - Intronic
913340478 1:117753216-117753238 CACCCTCTTCTCTTCTGGAAGGG - Intergenic
915823969 1:159056245-159056267 CAGCCCCTCCTCTTCCTGGGTGG - Intergenic
917963054 1:180159709-180159731 CACTCTCTCCTGATCTTGGAAGG + Intronic
918311740 1:183290033-183290055 CACCCTCTCCTCTCCCTGCCTGG + Intronic
921537919 1:216374987-216375009 CACTCTCTCCCCTCAGTGGATGG + Intronic
921855262 1:219975262-219975284 CACCCCCTCCTCTGCGTGAATGG - Intronic
922120301 1:222659993-222660015 CTCCCTTACCTCTCCGTGGAGGG - Exonic
923436064 1:233969233-233969255 GATCCTCTGGTCTTCGTGGAAGG - Intronic
924869523 1:248026338-248026360 CAACCTCTCCTCCTCTTAGAAGG + Intronic
1064334156 10:14423330-14423352 CAGCCCCTCCTCTTCCTGGGTGG + Intronic
1064481664 10:15746340-15746362 ATCCCTCTCCTGTTGGTGGAAGG + Intergenic
1070945955 10:80391835-80391857 CTCCCTCTCCTCTTCTGGCAGGG - Intergenic
1073326981 10:102648838-102648860 CACCCCCGAGTCTTCGTGGAAGG + Intronic
1074866600 10:117547542-117547564 TAGCGTCTCCTCTTCGTGGCGGG - Intronic
1075841813 10:125511273-125511295 ATCCCTCTCCTCTGCATGGATGG + Intergenic
1076701982 10:132278019-132278041 CACCCCCACCTCTCCCTGGAGGG - Intronic
1077378775 11:2218160-2218182 CAGCCTCTTCTCTTCCTGGGAGG + Intergenic
1078530299 11:12131659-12131681 CACCCTCTCTGCTTCCTGAAGGG + Intronic
1080645858 11:34186927-34186949 CACCCTCTCCCCTCCTGGGAGGG + Intronic
1080834331 11:35926528-35926550 CACACTCTCCTTTTCGTGGTGGG + Intergenic
1083264728 11:61541430-61541452 CACCCCCTGCTCTCCCTGGAGGG - Intronic
1084781009 11:71408111-71408133 GCCCCTCTCCCCTTCGTGGAAGG + Intergenic
1085512114 11:77093694-77093716 GACCCCCGCCTCTTTGTGGATGG + Exonic
1085638186 11:78174131-78174153 CAGCCTCTCCTCTTCCAGCATGG - Exonic
1086297364 11:85385327-85385349 CACAGTCAGCTCTTCGTGGAAGG + Intronic
1090839482 11:130475837-130475859 CACCCTCTCCTCCTGAAGGAGGG - Exonic
1091702382 12:2672642-2672664 TGTCCTCTCCTCTTCTTGGAAGG + Intronic
1092903261 12:13079724-13079746 ACCCCTCTCCTGTTAGTGGACGG + Intronic
1093520775 12:20047518-20047540 TACCCTCACCTCTTCCTGGCTGG + Intergenic
1096149331 12:49298611-49298633 CACCCACTTCTCATCGTGGCTGG - Exonic
1099909739 12:88814992-88815014 CACCCTCTTCCCTTCCAGGAAGG + Intergenic
1101881674 12:108630048-108630070 CCACCTCTCCTCTTCCTGGAAGG + Intronic
1102490644 12:113287913-113287935 GCCCTGCTCCTCTTCGTGGAAGG + Intronic
1103463880 12:121126457-121126479 CACTCTCTTCTCTACGTGGCTGG - Intergenic
1103885584 12:124197816-124197838 CTCCCTCTGCTCTCCTTGGATGG + Intronic
1103895692 12:124271690-124271712 TACACTCTCCTCTTCTTGTAAGG + Intronic
1104573369 12:129944855-129944877 CACCATCCCCTCATCCTGGATGG + Intergenic
1106894625 13:34285921-34285943 CACCCTCTACTCTTCTAGGTAGG + Intergenic
1107249876 13:38347064-38347086 CACTCTCTCCTCTTTGTATAAGG + Intergenic
1107430008 13:40332106-40332128 CCACCTCTCCTCTTCCAGGAAGG + Intergenic
1108046668 13:46389917-46389939 CAGCCTCTCCTTTTCCTGCATGG - Intronic
1110433873 13:75458086-75458108 CACCCTCTCCTCTTGGTACCCGG + Intronic
1112065038 13:95783932-95783954 CCCTCCCTCCTCTTCCTGGATGG - Intronic
1113157027 13:107334995-107335017 CATCCTCTCCTCATCTTTGATGG - Intronic
1113616487 13:111684255-111684277 CACCCTCACCTGTGCTTGGAAGG + Intergenic
1113622017 13:111769526-111769548 CACCCTCACCTGTGCTTGGAAGG + Intergenic
1122301111 14:100731634-100731656 CACCCTCTCCTGTTAGGGGAGGG - Intronic
1123946532 15:25241506-25241528 CACCCCCTTCTCCGCGTGGAGGG + Intergenic
1128254396 15:66186206-66186228 CACCCTCTCTGCTTCCCGGAGGG - Intronic
1129001755 15:72341404-72341426 CAACCTCTCCTCTCCTTGGTAGG - Exonic
1130122206 15:81060758-81060780 CACCCCCTCCTGCTTGTGGAGGG - Intronic
1133125539 16:3643534-3643556 CACCCACTCCGCTCCGTGGTGGG - Intronic
1133284145 16:4682846-4682868 CTCCTCATCCTCTTCGTGGATGG - Exonic
1141716439 16:85729706-85729728 CTCCCTCTCCTCCTCTTGTAAGG - Intronic
1141791896 16:86242739-86242761 CACTCTCCCCTCTTCGTCGTGGG + Intergenic
1143108536 17:4541235-4541257 CACCCTGTCCTCCTCCTGCAGGG - Intronic
1144053005 17:11514124-11514146 CACCCTCTCCTCTTCGTGGACGG + Intronic
1144536764 17:16097429-16097451 GCCCCTCTCCTCTCCCTGGAGGG - Intronic
1145239799 17:21234005-21234027 CTCCCTGTCCTACTCGTGGAGGG + Intergenic
1147915253 17:43881862-43881884 CACCCTCTCCCCTTGGAGAAGGG + Intronic
1147924973 17:43940638-43940660 CATCCTCTCCCCTTCGCAGAGGG - Intergenic
1154383794 18:13875601-13875623 CTCCCTCTCCCCTTCTTAGAAGG + Intergenic
1157298852 18:46465348-46465370 CTCCCTCTCCTTTTCCTAGATGG + Intergenic
1157589852 18:48829731-48829753 CACCCTCGGCTCTTAGTGCAGGG - Intronic
1161560723 19:4971153-4971175 AACCCTTTCCTCTTTGGGGAGGG + Intronic
1166046322 19:40233015-40233037 CACCCTCTCCTCTGCGGGGGTGG - Exonic
1167507894 19:49880793-49880815 CAGCATCACCTCTTCCTGGAAGG - Intronic
931921087 2:67016573-67016595 CACCTTCTCCTCATGGTGGCAGG + Intergenic
931984627 2:67729752-67729774 CACCCTCTCCTCTTAGCTCAGGG - Intergenic
932424480 2:71620431-71620453 CACCCTCTGCTCTTCCTCCAGGG - Intronic
932905828 2:75749988-75750010 CTCACTCTCCTCTTCCTGGGTGG - Intergenic
933839495 2:86275181-86275203 CACCATCTGCTCACCGTGGATGG + Intronic
935108738 2:100072375-100072397 CACCCTCACCTCCTCGTCCATGG + Intronic
935652616 2:105395381-105395403 CACCCACTCTTCTTCATGGCAGG + Intronic
935704188 2:105841605-105841627 GCCCCTCTCCCCTTCTTGGAGGG + Intronic
937262636 2:120596239-120596261 CACCCTCTGCCCTTCCAGGATGG + Intergenic
937850390 2:126627186-126627208 GCCCCTCTCCTCTTCCTGGAAGG + Intergenic
940017857 2:149125353-149125375 CACTCTTTCCTCTTCCTGGAGGG + Intronic
941018438 2:160383309-160383331 CATCCTATCCTCTTCTTGAAAGG + Intronic
941199599 2:162491906-162491928 CTCTGTCTTCTCTTCGTGGATGG + Intronic
948980836 2:241493993-241494015 CGCCCTCTCCTCCAGGTGGATGG + Exonic
1172952701 20:38731953-38731975 GATCCTCTCCACTTCCTGGATGG - Intergenic
1172972048 20:38880975-38880997 CAACCCCTCCTCTTCTTGAATGG + Intronic
1174328007 20:49794968-49794990 CACCCTCTCTTCCTCCTGGGAGG + Intergenic
1174742374 20:53027854-53027876 CACCCTCTCCTCTCCTTAAATGG - Intronic
1175806747 20:61833895-61833917 CGCCCCCTCCTCTTCGTCTATGG + Intronic
1176090811 20:63317871-63317893 CCCCCTCTCCTCTTCCTCGGTGG + Intronic
1176548676 21:8212472-8212494 CCCCCTCTCCTCTTGGGGGGGGG + Intergenic
1176567607 21:8395507-8395529 CCCCCTCTCCTCTTGGGGGGGGG + Intergenic
1179156328 21:38854108-38854130 CACCACCTCATCTTTGTGGAGGG + Intergenic
1180109148 21:45639900-45639922 CCACCTCTCCTCTTCGGGGCTGG - Intergenic
1182994256 22:34798477-34798499 CACCACCTCATCTTCTTGGATGG - Intergenic
1185022796 22:48389868-48389890 CCCTCTCTCCTCATCATGGAAGG + Intergenic
951434424 3:22644951-22644973 CACCCTTTCCCCTTGGTGAATGG + Intergenic
954864771 3:53718944-53718966 CAGCCTCTCCTCATGATGGAAGG + Intronic
957309127 3:78496867-78496889 CACCCACTCCTTTCCGTCGATGG - Intergenic
961673256 3:128549699-128549721 CACCCTCCCCTCTTTGTCCACGG - Intergenic
963741548 3:149086573-149086595 CGCACTCTCCTCTTCGTGATTGG - Intergenic
968615302 4:1575062-1575084 CACCCTGTCCTCTTGGTGGGCGG - Intergenic
974165428 4:58195593-58195615 CAGCCCCTCCTCTTCCTGGGTGG + Intergenic
974960749 4:68697146-68697168 CGGCCCCTCCTCTTCTTGGATGG + Intergenic
980729173 4:136804890-136804912 AACACACTCCTGTTCGTGGATGG + Intergenic
980770371 4:137364349-137364371 CACTCTACCCTCTTCTTGGATGG - Intergenic
981576511 4:146211675-146211697 CACCGCCTCCTCTCCGTGGTGGG + Intergenic
984850769 4:184150614-184150636 CACCCTCTCATCTTCCTGGGGGG - Intronic
985033863 4:185819347-185819369 CTCCCTCTCCTCTTCTTGCCTGG - Intronic
985238328 4:187901500-187901522 CACCCTCTTCTCCTCATGAAAGG - Intergenic
986236077 5:5912033-5912055 CACCCCTTCCTCTTCCTTGAAGG + Intergenic
986558976 5:9041629-9041651 CACCCTCACCTCTCCCTGCATGG - Exonic
989273016 5:39554570-39554592 CAACCTCTCCTTTGAGTGGAGGG + Intergenic
990995280 5:61726824-61726846 CACCCCTTTCTCTTCTTGGATGG - Intronic
992969382 5:82040196-82040218 AACCCTCTCCTCTTGATGGGAGG + Intronic
998823858 5:146081614-146081636 CACCATCTGCTCTTCATGCAGGG + Exonic
1000579646 5:163019741-163019763 TATCCTCTGCTCTTCGTGGGTGG - Intergenic
1001396377 5:171421665-171421687 AACCCTCTCCTGGGCGTGGAAGG - Intronic
1003036176 6:2642217-2642239 CTCCCTCCCCTCTTGGTTGATGG - Intergenic
1003923450 6:10855484-10855506 CACCCTATGCTCTTGGGGGAGGG + Intronic
1004062214 6:12208676-12208698 CCCCCTCTCCTCTTCTTCTAAGG - Intergenic
1004474926 6:15962409-15962431 CAGCCTCTACTCTTTGTTGAGGG - Intergenic
1009526343 6:64751254-64751276 CACCAACTCCTCTGCGTGGGAGG - Intronic
1010658844 6:78544978-78545000 CATCCTTTCCTTTTCCTGGATGG - Intergenic
1012602234 6:101112893-101112915 TCCCTTCTCCTCTTCGAGGATGG - Intergenic
1012994139 6:105956996-105957018 CACCCTGTTCCCTTCTTGGATGG - Intergenic
1013393149 6:109706917-109706939 CCCCCTCTCCTCTCAGTGGTGGG + Intronic
1014170602 6:118274898-118274920 CACCCTCTGCTATTCAGGGAGGG - Intronic
1020215577 7:6187501-6187523 CTCCCCCTACTCTGCGTGGAGGG - Intronic
1022393735 7:29966324-29966346 CACCTTTCCCTCTTCGTGGAAGG + Intronic
1022475848 7:30709037-30709059 CCCCATCTCATCTTCATGGATGG - Intronic
1023619088 7:42051310-42051332 CACCTTCTCCTCTTCCTTAAAGG + Intronic
1028458696 7:91066884-91066906 CACCTTCTCCTCTTAGTGCAGGG - Intronic
1029350469 7:100009768-100009790 CACCTTCCCCTCTTAGTGAATGG - Intergenic
1032353196 7:131185048-131185070 CACCCTCTCCTCCTCTCGGGTGG - Intronic
1035882808 8:3260584-3260606 CAGCCTCTGCTCTTCGAGGGGGG - Intronic
1039846840 8:41331487-41331509 CATCCTCTCCACTTCACGGAGGG - Intergenic
1039849095 8:41346856-41346878 CCCCCTCTTCTTTTCCTGGAAGG - Intergenic
1040521382 8:48178982-48179004 CACCTTCTTCTCCTTGTGGAGGG + Intergenic
1041704079 8:60826752-60826774 CAGCATCCCCTCCTCGTGGATGG - Intronic
1042694278 8:71539322-71539344 CACTCTCTGCTCTTCTTAGATGG - Intronic
1043283577 8:78501337-78501359 CACCCTCTCCACATGGTGGCAGG + Intergenic
1045921535 8:107535835-107535857 CACCCTCTCCCCTCCGTATAAGG - Intergenic
1052865483 9:33462419-33462441 CTCCCACTCCTCTTCTGGGATGG + Exonic
1057205908 9:93172499-93172521 CTTCCTCTCCTCTTTCTGGATGG - Intergenic
1058502358 9:105633732-105633754 CAGCCTCTCCTTTTCATGTATGG + Intronic
1059971128 9:119669304-119669326 CACCCTATCCTCTTTGTGTTTGG - Intergenic
1061091918 9:128431290-128431312 CACCCTCACCTCTTCCCAGATGG - Exonic
1062386257 9:136312667-136312689 CACCCTCTCCCCATCCTGGTGGG + Intergenic
1187812988 X:23200612-23200634 CACCCTCTCCTAATTGTGGCTGG - Intergenic
1192562807 X:72138706-72138728 AACCTTCTCCACTTCCTGGAAGG + Exonic
1194972746 X:100362266-100362288 CACCCTTTCCTCATCCTGGTCGG + Intronic
1195365128 X:104117329-104117351 CACACTCACCTCTTGGTGGAGGG + Intronic